\
| Variant ID: vg0920821502 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 20821502 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATCTGATTCGGCCACGTGTTACATTGCTGACTTCAAACGGCCGCCAAATCTACATACGTGCTCCGTTTTGGGCCCGTGAGTACTTGATGGAAAGCTCTCG[A/G]
AGTCCTCCTTCCAACGGATCCAGCCTCATCTCGAAATTCTATCTCGTTTGGCCGCAAGGTGCTGCGTCACCTGTATTGGGCCAATGGGCTTGTAACTTTG
CAAAGTTACAAGCCCATTGGCCCAATACAGGTGACGCAGCACCTTGCGGCCAAACGAGATAGAATTTCGAGATGAGGCTGGATCCGTTGGAAGGAGGACT[T/C]
CGAGAGCTTTCCATCAAGTACTCACGGGCCCAAAACGGAGCACGTATGTAGATTTGGCGGCCGTTTGAAGTCAGCAATGTAACACGTGGCCGAATCAGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.90% | 42.50% | 1.04% | 7.64% | NA |
| All Indica | 2759 | 82.70% | 11.30% | 1.01% | 4.89% | NA |
| All Japonica | 1512 | 0.10% | 99.40% | 0.13% | 0.33% | NA |
| Aus | 269 | 1.50% | 13.80% | 6.69% | 78.07% | NA |
| Indica I | 595 | 86.90% | 9.40% | 1.18% | 2.52% | NA |
| Indica II | 465 | 84.10% | 7.50% | 0.65% | 7.74% | NA |
| Indica III | 913 | 84.60% | 11.60% | 0.66% | 3.18% | NA |
| Indica Intermediate | 786 | 76.70% | 14.80% | 1.53% | 7.00% | NA |
| Temperate Japonica | 767 | 0.10% | 99.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 96.70% | 0.83% | 2.07% | NA |
| VI/Aromatic | 96 | 0.00% | 95.80% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 22.20% | 68.90% | 1.11% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0920821502 | A -> G | LOC_Os09g36140-LOC_Os09g36150 | intergenic_region ; MODIFIER | silent_mutation | Average:38.044; most accessible tissue: Zhenshan97 panicle, score: 78.302 | N | N | N | N |
| vg0920821502 | A -> DEL | N | N | silent_mutation | Average:38.044; most accessible tissue: Zhenshan97 panicle, score: 78.302 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0920821502 | NA | 1.56E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920821502 | NA | 2.56E-10 | mr1047 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920821502 | NA | 5.29E-08 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920821502 | NA | 5.53E-07 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920821502 | NA | 5.15E-08 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920821502 | NA | 8.91E-09 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920821502 | NA | 8.93E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920821502 | NA | 5.14E-10 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920821502 | NA | 2.68E-06 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |