\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920819355:

Variant ID: vg0920819355 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20819355
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


GGATACAAGTTCGTAGCTCTGGGATAAACTGGAGTGCATAGCATTATAGCAGCAACGTTTGGTCTCATCGTTTGGCTTATTTCCTAATAAACCAAAACGG[T/C]
TTATTAGGAAATAAAAATGATTTTGTACGTAAAACTTTTATAAATGTGTTCTTTGTGACTTAAAAGCTAATGTTGAAAAAGAAACTACATCAAAAATATC

Reverse complement sequence

GATATTTTTGATGTAGTTTCTTTTTCAACATTAGCTTTTAAGTCACAAAGAACACATTTATAAAAGTTTTACGTACAAAATCATTTTTATTTCCTAATAA[A/G]
CCGTTTTGGTTTATTAGGAAATAAGCCAAACGATGAGACCAAACGTTGCTGCTATAATGCTATGCACTCCAGTTTATCCCAGAGCTACGAACTTGTATCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.70% 41.10% 0.13% 0.08% NA
All Indica  2759 90.10% 9.60% 0.18% 0.11% NA
All Japonica  1512 0.60% 99.30% 0.07% 0.00% NA
Aus  269 90.30% 9.70% 0.00% 0.00% NA
Indica I  595 91.60% 7.60% 0.50% 0.34% NA
Indica II  465 92.70% 7.10% 0.22% 0.00% NA
Indica III  913 88.80% 11.10% 0.11% 0.00% NA
Indica Intermediate  786 88.80% 11.10% 0.00% 0.13% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.00% 100.00% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.30% 0.41% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 33.30% 65.60% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920819355 T -> DEL N N silent_mutation Average:47.433; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0920819355 T -> C LOC_Os09g36140-LOC_Os09g36150 intergenic_region ; MODIFIER silent_mutation Average:47.433; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920819355 NA 3.17E-08 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920819355 NA 4.89E-11 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920819355 NA 2.80E-08 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920819355 NA 1.99E-29 mr1333 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920819355 1.59E-06 1.03E-22 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920819355 3.95E-06 7.67E-07 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920819355 NA 5.49E-37 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920819355 NA 7.93E-24 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920819355 NA 3.22E-07 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920819355 NA 4.60E-26 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920819355 NA 2.66E-19 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920819355 NA 7.07E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920819355 NA 5.39E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920819355 NA 1.58E-07 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920819355 1.36E-06 5.04E-10 mr1219_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920819355 1.10E-06 3.99E-09 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920819355 NA 4.27E-20 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920819355 NA 1.68E-25 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920819355 NA 2.63E-07 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251