\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920644583:

Variant ID: vg0920644583 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 20644583
Reference Allele: TAAlternative Allele: T,TAA,AA
Primary Allele: TASecondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGACACCATTCGTACAACTCATTATGGAATTTGTGACAGCGTTATGGAAATATTCCAAGTTCGCACGAAAGCTTACACTAAACTGAATTTTATTTTTTTT[TA/T,TAA,AA]
AAAAAAAATAGCCGCCGTGCCATTGCCACCCCACCCAGGCAGCCAGGCAGGCTGTTACTCCGTACCAATGGAGAGCGAACGGGCACAGTAGATCCGGATT

Reverse complement sequence

AATCCGGATCTACTGTGCCCGTTCGCTCTCCATTGGTACGGAGTAACAGCCTGCCTGGCTGCCTGGGTGGGGTGGCAATGGCACGGCGGCTATTTTTTTT[TA/A,TTA,TT]
AAAAAAAATAAAATTCAGTTTAGTGTAAGCTTTCGTGCGAACTTGGAATATTTCCATAACGCTGTCACAAATTCCATAATGAGTTGTACGAATGGTGTCC

Allele Frequencies:

Populations Population SizeFrequency of TA(primary allele) Frequency of AA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.40% 8.90% 1.78% 0.00% T: 0.66%; TAA: 0.28%
All Indica  2759 94.10% 3.30% 1.38% 0.00% T: 1.09%; TAA: 0.07%
All Japonica  1512 77.10% 19.80% 2.58% 0.00% TAA: 0.53%; T: 0.07%
Aus  269 94.40% 4.10% 1.12% 0.00% TAA: 0.37%
Indica I  595 97.50% 0.20% 2.35% 0.00% NA
Indica II  465 92.00% 6.20% 1.51% 0.00% TAA: 0.22%
Indica III  913 92.40% 4.40% 0.66% 0.00% T: 2.41%; TAA: 0.11%
Indica Intermediate  786 94.80% 2.80% 1.40% 0.00% T: 1.02%
Temperate Japonica  767 95.30% 3.10% 1.43% 0.00% T: 0.13%
Tropical Japonica  504 45.40% 49.00% 4.37% 0.00% TAA: 1.19%
Japonica Intermediate  241 85.10% 11.60% 2.49% 0.00% TAA: 0.83%
VI/Aromatic  96 93.80% 4.20% 1.04% 0.00% TAA: 1.04%
Intermediate  90 81.10% 14.40% 3.33% 0.00% TAA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920644583 TA -> T LOC_Os09g35870.1 upstream_gene_variant ; 1445.0bp to feature; MODIFIER silent_mutation Average:91.619; most accessible tissue: Minghui63 panicle, score: 96.252 N N N N
vg0920644583 TA -> T LOC_Os09g35860.1 downstream_gene_variant ; 4815.0bp to feature; MODIFIER silent_mutation Average:91.619; most accessible tissue: Minghui63 panicle, score: 96.252 N N N N
vg0920644583 TA -> T LOC_Os09g35880.1 downstream_gene_variant ; 1813.0bp to feature; MODIFIER silent_mutation Average:91.619; most accessible tissue: Minghui63 panicle, score: 96.252 N N N N
vg0920644583 TA -> T LOC_Os09g35870-LOC_Os09g35880 intergenic_region ; MODIFIER silent_mutation Average:91.619; most accessible tissue: Minghui63 panicle, score: 96.252 N N N N
vg0920644583 TA -> AA LOC_Os09g35870.1 upstream_gene_variant ; 1444.0bp to feature; MODIFIER silent_mutation Average:91.619; most accessible tissue: Minghui63 panicle, score: 96.252 N N N N
vg0920644583 TA -> AA LOC_Os09g35860.1 downstream_gene_variant ; 4814.0bp to feature; MODIFIER silent_mutation Average:91.619; most accessible tissue: Minghui63 panicle, score: 96.252 N N N N
vg0920644583 TA -> AA LOC_Os09g35880.1 downstream_gene_variant ; 1814.0bp to feature; MODIFIER silent_mutation Average:91.619; most accessible tissue: Minghui63 panicle, score: 96.252 N N N N
vg0920644583 TA -> AA LOC_Os09g35870-LOC_Os09g35880 intergenic_region ; MODIFIER silent_mutation Average:91.619; most accessible tissue: Minghui63 panicle, score: 96.252 N N N N
vg0920644583 TA -> TAA LOC_Os09g35870.1 upstream_gene_variant ; 1446.0bp to feature; MODIFIER silent_mutation Average:91.619; most accessible tissue: Minghui63 panicle, score: 96.252 N N N N
vg0920644583 TA -> TAA LOC_Os09g35860.1 downstream_gene_variant ; 4816.0bp to feature; MODIFIER silent_mutation Average:91.619; most accessible tissue: Minghui63 panicle, score: 96.252 N N N N
vg0920644583 TA -> TAA LOC_Os09g35880.1 downstream_gene_variant ; 1812.0bp to feature; MODIFIER silent_mutation Average:91.619; most accessible tissue: Minghui63 panicle, score: 96.252 N N N N
vg0920644583 TA -> TAA LOC_Os09g35870-LOC_Os09g35880 intergenic_region ; MODIFIER silent_mutation Average:91.619; most accessible tissue: Minghui63 panicle, score: 96.252 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0920644583 TA AA -0.02 0.02 0.0 0.01 0.01 0.0
vg0920644583 TA T 0.0 0.04 0.03 0.0 0.06 0.03
vg0920644583 TA TAA 0.08 0.13 0.05 0.06 0.08 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920644583 4.01E-07 1.73E-06 mr1098_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920644583 1.06E-08 1.25E-07 mr1150_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251