Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920478307:

Variant ID: vg0920478307 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20478307
Reference Allele: TAlternative Allele: C,G
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


TGCGATGCTACAATAAACATTTGCTAATAATGGATTAATTAGGCTTAATAAATTTATCTCGCAGTTTACATGCAGAATCTGTAATTTGTTTTGTTATTAG[T/C,G]
CTACGTTTAATACTTTAAATATATGTCTGTATACTTTAAAAAATTTTGACACACAAACTAAACATAGCCTAGGCAGTAGCTAATGGCTTAGCTCTTGGGC

Reverse complement sequence

GCCCAAGAGCTAAGCCATTAGCTACTGCCTAGGCTATGTTTAGTTTGTGTGTCAAAATTTTTTAAAGTATACAGACATATATTTAAAGTATTAAACGTAG[A/G,C]
CTAATAACAAAACAAATTACAGATTCTGCATGTAAACTGCGAGATAAATTTATTAAGCCTAATTAATCCATTATTAGCAAATGTTTATTGTAGCATCGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.10% 7.50% 0.34% 0.00% G: 0.04%
All Indica  2759 91.30% 8.40% 0.29% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 55.00% 42.00% 2.97% 0.00% NA
Indica I  595 99.20% 0.20% 0.67% 0.00% NA
Indica II  465 87.70% 11.80% 0.43% 0.00% NA
Indica III  913 87.40% 12.50% 0.11% 0.00% NA
Indica Intermediate  786 91.90% 8.00% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 90.00% 7.80% 0.00% 0.00% G: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920478307 T -> G LOC_Os09g35600-LOC_Os09g35620 intergenic_region ; MODIFIER silent_mutation Average:84.306; most accessible tissue: Minghui63 young leaf, score: 94.396 N N N N
vg0920478307 T -> C LOC_Os09g35600-LOC_Os09g35620 intergenic_region ; MODIFIER silent_mutation Average:84.306; most accessible tissue: Minghui63 young leaf, score: 94.396 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0920478307 T C 0.01 0.03 0.04 0.01 0.03 0.03
vg0920478307 T G 0.01 0.03 0.05 0.01 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920478307 1.27E-06 2.90E-06 mr1113_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920478307 5.21E-07 2.60E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920478307 1.41E-06 NA mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920478307 3.48E-06 NA mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920478307 3.35E-08 NA mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920478307 9.05E-06 NA mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920478307 NA 5.58E-06 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920478307 3.50E-07 NA mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251