\
| Variant ID: vg0920468505 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr09 | Position: 20468505 |
| Reference Allele: T | Alternative Allele: A,TA,TTA |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.75, T: 0.25, others allele: 0.00, population size: 141. )
GTCATTGGAGTGTCTTACCAAGTTACAAACAACAATAATCAATCCAAACAGAGAAGGCAAAGCTCTTCAAATGTCAACAAAATATTGGAGATATTTTTTT[T/A,TA,TTA]
AAAAAAATGATAACCTATAATATGACACTTAGGAAGCAACCCTCGGGACTATTTCAAGCCTAGTCATTATCTACACATCGAGATACAGAGAAAGAAAATT
AATTTTCTTTCTCTGTATCTCGATGTGTAGATAATGACTAGGCTTGAAATAGTCCCGAGGGTTGCTTCCTAAGTGTCATATTATAGGTTATCATTTTTTT[A/T,TA,TAA]
AAAAAAATATCTCCAATATTTTGTTGACATTTGAAGAGCTTTGCCTTCTCTGTTTGGATTGATTATTGTTGTTTGTAACTTGGTAAGACACTCCAATGAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.50% | 17.70% | 3.55% | 0.00% | TTA: 0.15%; TA: 0.11% |
| All Indica | 2759 | 89.20% | 10.20% | 0.43% | 0.00% | TTA: 0.18% |
| All Japonica | 1512 | 55.70% | 35.20% | 9.13% | 0.00% | NA |
| Aus | 269 | 96.70% | 1.50% | 1.12% | 0.00% | TTA: 0.74% |
| Indica I | 595 | 94.30% | 5.20% | 0.50% | 0.00% | NA |
| Indica II | 465 | 83.40% | 15.30% | 1.08% | 0.00% | TTA: 0.22% |
| Indica III | 913 | 88.40% | 11.30% | 0.11% | 0.00% | TTA: 0.22% |
| Indica Intermediate | 786 | 89.70% | 9.70% | 0.38% | 0.00% | TTA: 0.25% |
| Temperate Japonica | 767 | 29.60% | 58.80% | 11.60% | 0.00% | NA |
| Tropical Japonica | 504 | 86.50% | 7.70% | 5.75% | 0.00% | NA |
| Japonica Intermediate | 241 | 74.30% | 17.40% | 8.30% | 0.00% | NA |
| VI/Aromatic | 96 | 81.20% | 2.10% | 11.46% | 0.00% | TA: 5.21% |
| Intermediate | 90 | 74.40% | 21.10% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0920468505 | T -> TA | LOC_Os09g35600.1 | downstream_gene_variant ; 1316.0bp to feature; MODIFIER | silent_mutation | Average:59.74; most accessible tissue: Callus, score: 93.652 | N | N | N | N |
| vg0920468505 | T -> TA | LOC_Os09g35590-LOC_Os09g35600 | intergenic_region ; MODIFIER | silent_mutation | Average:59.74; most accessible tissue: Callus, score: 93.652 | N | N | N | N |
| vg0920468505 | T -> TTA | LOC_Os09g35600.1 | downstream_gene_variant ; 1316.0bp to feature; MODIFIER | silent_mutation | Average:59.74; most accessible tissue: Callus, score: 93.652 | N | N | N | N |
| vg0920468505 | T -> TTA | LOC_Os09g35590-LOC_Os09g35600 | intergenic_region ; MODIFIER | silent_mutation | Average:59.74; most accessible tissue: Callus, score: 93.652 | N | N | N | N |
| vg0920468505 | T -> A | LOC_Os09g35600.1 | downstream_gene_variant ; 1317.0bp to feature; MODIFIER | silent_mutation | Average:59.74; most accessible tissue: Callus, score: 93.652 | N | N | N | N |
| vg0920468505 | T -> A | LOC_Os09g35590-LOC_Os09g35600 | intergenic_region ; MODIFIER | silent_mutation | Average:59.74; most accessible tissue: Callus, score: 93.652 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0920468505 | NA | 6.66E-13 | mr1022 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 2.31E-09 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 3.93E-12 | mr1079 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 7.02E-06 | mr1117 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 9.01E-12 | mr1142 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 8.28E-08 | mr1301 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 1.05E-07 | mr1410 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 2.22E-10 | mr1491 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 5.18E-06 | mr1518 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 2.06E-11 | mr1546 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 1.37E-06 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 1.77E-10 | mr1023_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 8.13E-07 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 3.02E-12 | mr1079_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 8.07E-08 | mr1089_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 7.96E-09 | mr1093_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | 3.71E-06 | 1.13E-06 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 6.59E-06 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 3.08E-12 | mr1132_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 2.15E-08 | mr1235_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 3.34E-06 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 1.91E-06 | mr1358_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 1.21E-10 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 5.95E-06 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | 4.41E-07 | NA | mr1496_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 4.51E-11 | mr1546_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 8.27E-06 | mr1577_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 4.62E-08 | mr1676_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 5.15E-06 | mr1682_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 6.86E-07 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | 4.47E-07 | NA | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 9.95E-06 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920468505 | NA | 5.83E-08 | mr1830_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |