\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920468505:

Variant ID: vg0920468505 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 20468505
Reference Allele: TAlternative Allele: A,TA,TTA
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.75, T: 0.25, others allele: 0.00, population size: 141. )

Flanking Sequence (100 bp) in Reference Genome:


GTCATTGGAGTGTCTTACCAAGTTACAAACAACAATAATCAATCCAAACAGAGAAGGCAAAGCTCTTCAAATGTCAACAAAATATTGGAGATATTTTTTT[T/A,TA,TTA]
AAAAAAATGATAACCTATAATATGACACTTAGGAAGCAACCCTCGGGACTATTTCAAGCCTAGTCATTATCTACACATCGAGATACAGAGAAAGAAAATT

Reverse complement sequence

AATTTTCTTTCTCTGTATCTCGATGTGTAGATAATGACTAGGCTTGAAATAGTCCCGAGGGTTGCTTCCTAAGTGTCATATTATAGGTTATCATTTTTTT[A/T,TA,TAA]
AAAAAAATATCTCCAATATTTTGTTGACATTTGAAGAGCTTTGCCTTCTCTGTTTGGATTGATTATTGTTGTTTGTAACTTGGTAAGACACTCCAATGAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.50% 17.70% 3.55% 0.00% TTA: 0.15%; TA: 0.11%
All Indica  2759 89.20% 10.20% 0.43% 0.00% TTA: 0.18%
All Japonica  1512 55.70% 35.20% 9.13% 0.00% NA
Aus  269 96.70% 1.50% 1.12% 0.00% TTA: 0.74%
Indica I  595 94.30% 5.20% 0.50% 0.00% NA
Indica II  465 83.40% 15.30% 1.08% 0.00% TTA: 0.22%
Indica III  913 88.40% 11.30% 0.11% 0.00% TTA: 0.22%
Indica Intermediate  786 89.70% 9.70% 0.38% 0.00% TTA: 0.25%
Temperate Japonica  767 29.60% 58.80% 11.60% 0.00% NA
Tropical Japonica  504 86.50% 7.70% 5.75% 0.00% NA
Japonica Intermediate  241 74.30% 17.40% 8.30% 0.00% NA
VI/Aromatic  96 81.20% 2.10% 11.46% 0.00% TA: 5.21%
Intermediate  90 74.40% 21.10% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920468505 T -> TA LOC_Os09g35600.1 downstream_gene_variant ; 1316.0bp to feature; MODIFIER silent_mutation Average:59.74; most accessible tissue: Callus, score: 93.652 N N N N
vg0920468505 T -> TA LOC_Os09g35590-LOC_Os09g35600 intergenic_region ; MODIFIER silent_mutation Average:59.74; most accessible tissue: Callus, score: 93.652 N N N N
vg0920468505 T -> TTA LOC_Os09g35600.1 downstream_gene_variant ; 1316.0bp to feature; MODIFIER silent_mutation Average:59.74; most accessible tissue: Callus, score: 93.652 N N N N
vg0920468505 T -> TTA LOC_Os09g35590-LOC_Os09g35600 intergenic_region ; MODIFIER silent_mutation Average:59.74; most accessible tissue: Callus, score: 93.652 N N N N
vg0920468505 T -> A LOC_Os09g35600.1 downstream_gene_variant ; 1317.0bp to feature; MODIFIER silent_mutation Average:59.74; most accessible tissue: Callus, score: 93.652 N N N N
vg0920468505 T -> A LOC_Os09g35590-LOC_Os09g35600 intergenic_region ; MODIFIER silent_mutation Average:59.74; most accessible tissue: Callus, score: 93.652 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920468505 NA 6.66E-13 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 2.31E-09 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 3.93E-12 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 7.02E-06 mr1117 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 9.01E-12 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 8.28E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 1.05E-07 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 2.22E-10 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 5.18E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 2.06E-11 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 1.37E-06 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 1.77E-10 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 8.13E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 3.02E-12 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 8.07E-08 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 7.96E-09 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 3.71E-06 1.13E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 6.59E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 3.08E-12 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 2.15E-08 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 3.34E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 1.91E-06 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 1.21E-10 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 5.95E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 4.41E-07 NA mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 4.51E-11 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 8.27E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 4.62E-08 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 5.15E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 6.86E-07 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 4.47E-07 NA mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 9.95E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920468505 NA 5.83E-08 mr1830_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251