Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920461569:

Variant ID: vg0920461569 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 20461569
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTATAGAGAATAGTTAACCACTATATAAATGAGCTGAGAGATAAGCTGTGAAGATCTATACAGTAAGCAGCTGGCTGTATTATTATCCTTGCTCTTAG[A/G]
CAAGGCTTTTATTCGGTGGCCCTTGAGGCCACGAAAACTTCTTCAACTACCTCGAAAAAGAAAAAAAAAAGAACATCTACAGTTATGCGATTAAATTGCT

Reverse complement sequence

AGCAATTTAATCGCATAACTGTAGATGTTCTTTTTTTTTTCTTTTTCGAGGTAGTTGAAGAAGTTTTCGTGGCCTCAAGGGCCACCGAATAAAAGCCTTG[T/C]
CTAAGAGCAAGGATAATAATACAGCCAGCTGCTTACTGTATAGATCTTCACAGCTTATCTCTCAGCTCATTTATATAGTGGTTAACTATTCTCTATAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.70%	12.90%	2.41%	0.00%	NA
All Indica	2759	97.40%	2.40%	0.18%	0.00%	NA
All Japonica	1512	58.10%	34.90%	7.01%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	95.60%	4.20%	0.17%	0.00%	NA
Indica II	465	95.90%	3.70%	0.43%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	96.90%	2.80%	0.25%	0.00%	NA
Temperate Japonica	767	29.70%	60.40%	9.91%	0.00%	NA
Tropical Japonica	504	91.70%	5.00%	3.37%	0.00%	NA
Japonica Intermediate	241	78.40%	16.20%	5.39%	0.00%	NA
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	82.20%	15.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0920461569	A -> G	LOC_Os09g35590.1	downstream_gene_variant ; 4069.0bp to feature; MODIFIER	silent_mutation	Average:61.219; most accessible tissue: Callus, score: 97.027	N	N	N	N
vg0920461569	A -> G	LOC_Os09g35590-LOC_Os09g35600	intergenic_region ; MODIFIER	silent_mutation	Average:61.219; most accessible tissue: Callus, score: 97.027	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0920461569	NA	9.58E-12	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569	NA	3.22E-12	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569	NA	7.86E-06	mr1482	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569	2.33E-07	NA	mr1518	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569	NA	1.18E-07	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569	NA	3.17E-10	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569	NA	6.18E-12	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569	NA	1.59E-07	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569	NA	1.41E-11	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569	NA	4.15E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569	NA	5.87E-14	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569	NA	6.44E-07	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569	NA	1.81E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569	NA	2.41E-06	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569	NA	2.60E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569	NA	8.42E-07	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569	NA	5.82E-08	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569	NA	1.23E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569	NA	4.84E-07	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569	NA	1.70E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251