\
| Variant ID: vg0920461569 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 20461569 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 286. )
ATTTATAGAGAATAGTTAACCACTATATAAATGAGCTGAGAGATAAGCTGTGAAGATCTATACAGTAAGCAGCTGGCTGTATTATTATCCTTGCTCTTAG[A/G]
CAAGGCTTTTATTCGGTGGCCCTTGAGGCCACGAAAACTTCTTCAACTACCTCGAAAAAGAAAAAAAAAAGAACATCTACAGTTATGCGATTAAATTGCT
AGCAATTTAATCGCATAACTGTAGATGTTCTTTTTTTTTTCTTTTTCGAGGTAGTTGAAGAAGTTTTCGTGGCCTCAAGGGCCACCGAATAAAAGCCTTG[T/C]
CTAAGAGCAAGGATAATAATACAGCCAGCTGCTTACTGTATAGATCTTCACAGCTTATCTCTCAGCTCATTTATATAGTGGTTAACTATTCTCTATAAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.70% | 12.90% | 2.41% | 0.00% | NA |
| All Indica | 2759 | 97.40% | 2.40% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 58.10% | 34.90% | 7.01% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.60% | 4.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.70% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.90% | 2.80% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 29.70% | 60.40% | 9.91% | 0.00% | NA |
| Tropical Japonica | 504 | 91.70% | 5.00% | 3.37% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.40% | 16.20% | 5.39% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 15.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0920461569 | A -> G | LOC_Os09g35590.1 | downstream_gene_variant ; 4069.0bp to feature; MODIFIER | silent_mutation | Average:61.219; most accessible tissue: Callus, score: 97.027 | N | N | N | N |
| vg0920461569 | A -> G | LOC_Os09g35590-LOC_Os09g35600 | intergenic_region ; MODIFIER | silent_mutation | Average:61.219; most accessible tissue: Callus, score: 97.027 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0920461569 | NA | 9.58E-12 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920461569 | NA | 3.22E-12 | mr1182 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920461569 | NA | 7.86E-06 | mr1482 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920461569 | 2.33E-07 | NA | mr1518 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920461569 | NA | 1.18E-07 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920461569 | NA | 3.17E-10 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920461569 | NA | 6.18E-12 | mr1650 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920461569 | NA | 1.59E-07 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920461569 | NA | 1.41E-11 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920461569 | NA | 4.15E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920461569 | NA | 5.87E-14 | mr1182_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920461569 | NA | 6.44E-07 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920461569 | NA | 1.81E-07 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920461569 | NA | 2.41E-06 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920461569 | NA | 2.60E-06 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920461569 | NA | 8.42E-07 | mr1570_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920461569 | NA | 5.82E-08 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920461569 | NA | 1.23E-06 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920461569 | NA | 4.84E-07 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920461569 | NA | 1.70E-06 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |