\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920461569:

Variant ID: vg0920461569 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20461569
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTATAGAGAATAGTTAACCACTATATAAATGAGCTGAGAGATAAGCTGTGAAGATCTATACAGTAAGCAGCTGGCTGTATTATTATCCTTGCTCTTAG[A/G]
CAAGGCTTTTATTCGGTGGCCCTTGAGGCCACGAAAACTTCTTCAACTACCTCGAAAAAGAAAAAAAAAAGAACATCTACAGTTATGCGATTAAATTGCT

Reverse complement sequence

AGCAATTTAATCGCATAACTGTAGATGTTCTTTTTTTTTTCTTTTTCGAGGTAGTTGAAGAAGTTTTCGTGGCCTCAAGGGCCACCGAATAAAAGCCTTG[T/C]
CTAAGAGCAAGGATAATAATACAGCCAGCTGCTTACTGTATAGATCTTCACAGCTTATCTCTCAGCTCATTTATATAGTGGTTAACTATTCTCTATAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.70% 12.90% 2.41% 0.00% NA
All Indica  2759 97.40% 2.40% 0.18% 0.00% NA
All Japonica  1512 58.10% 34.90% 7.01% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.60% 4.20% 0.17% 0.00% NA
Indica II  465 95.90% 3.70% 0.43% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 96.90% 2.80% 0.25% 0.00% NA
Temperate Japonica  767 29.70% 60.40% 9.91% 0.00% NA
Tropical Japonica  504 91.70% 5.00% 3.37% 0.00% NA
Japonica Intermediate  241 78.40% 16.20% 5.39% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 82.20% 15.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920461569 A -> G LOC_Os09g35590.1 downstream_gene_variant ; 4069.0bp to feature; MODIFIER silent_mutation Average:61.219; most accessible tissue: Callus, score: 97.027 N N N N
vg0920461569 A -> G LOC_Os09g35590-LOC_Os09g35600 intergenic_region ; MODIFIER silent_mutation Average:61.219; most accessible tissue: Callus, score: 97.027 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920461569 NA 9.58E-12 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569 NA 3.22E-12 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569 NA 7.86E-06 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569 2.33E-07 NA mr1518 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569 NA 1.18E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569 NA 3.17E-10 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569 NA 6.18E-12 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569 NA 1.59E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569 NA 1.41E-11 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569 NA 4.15E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569 NA 5.87E-14 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569 NA 6.44E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569 NA 1.81E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569 NA 2.41E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569 NA 2.60E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569 NA 8.42E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569 NA 5.82E-08 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569 NA 1.23E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569 NA 4.84E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920461569 NA 1.70E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251