\
| Variant ID: vg0920369641 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 20369641 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTCTGATTTTGTGACCTGGTGAACTTTGTTTAACTCCCTTGTTTCTTCACAGCTTGTGCAGAAGAGTTTTGCTCGGCTTTACTATAATGATTTCACGCGC[G/A]
ACTGCAGGTTTGTAATATCTTCTCTTCCATTTCCCCCTTTCGAGAAAAGCTGAGCTTAGCTCTCAGATTTGTCTCTCTAACATGGACAGTATTTAGAATT
AATTCTAAATACTGTCCATGTTAGAGAGACAAATCTGAGAGCTAAGCTCAGCTTTTCTCGAAAGGGGGAAATGGAAGAGAAGATATTACAAACCTGCAGT[C/T]
GCGCGTGAAATCATTATAGTAAAGCCGAGCAAAACTCTTCTGCACAAGCTGTGAAGAAACAAGGGAGTTAAACAAAGTTCACCAGGTCACAAAATCAGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.60% | 2.10% | 0.36% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.70% | 6.20% | 1.12% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.30% | 1.30% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 82.10% | 15.70% | 2.18% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.10% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0920369641 | G -> A | LOC_Os09g34960.1 | missense_variant ; p.Asp271Asn; MODERATE | nonsynonymous_codon ; D271N | Average:38.015; most accessible tissue: Zhenshan97 panicle, score: 61.671 | unknown | unknown | TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0920369641 | NA | 4.60E-06 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | NA | 7.32E-06 | mr1037_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | NA | 6.42E-06 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | 7.28E-06 | 7.28E-06 | mr1230_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | NA | 1.82E-07 | mr1232_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | 1.05E-06 | 1.05E-06 | mr1384_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | NA | 2.43E-08 | mr1401_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | 5.96E-06 | 5.95E-06 | mr1407_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | 5.74E-06 | 3.31E-07 | mr1415_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | 2.80E-06 | 2.80E-06 | mr1424_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | 5.83E-07 | 5.83E-07 | mr1511_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | NA | 6.71E-11 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | 5.75E-07 | 5.75E-07 | mr1547_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | 2.65E-06 | 9.20E-09 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | NA | 2.58E-07 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | 3.10E-07 | 3.10E-07 | mr1562_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | NA | 1.99E-06 | mr1575_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | NA | 2.08E-06 | mr1600_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | NA | 3.75E-07 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | NA | 5.30E-07 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | NA | 5.60E-07 | mr1849_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | NA | 1.95E-06 | mr1884_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | NA | 1.72E-07 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | 7.17E-06 | 7.17E-06 | mr1934_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920369641 | 4.22E-06 | 7.96E-08 | mr1944_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |