\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920361183:

Variant ID: vg0920361183 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20361183
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


AGTGCTGCAGCGTTATATTACTACCACAGTGAGGTACTGCAGCTGATTTTCGTATAGAAAAACATATCAAAGAAAAATAAAATCGAAAATATTCCAAGAT[A/G]
ACTATGAAAACATCAATTGAAAGAGAGATTGAGAGTTATCGAGAATCCTAATTCTTGCCATTTAGAATGGATCCAATTCCATTAAATCTGACTCAGCGAT

Reverse complement sequence

ATCGCTGAGTCAGATTTAATGGAATTGGATCCATTCTAAATGGCAAGAATTAGGATTCTCGATAACTCTCAATCTCTCTTTCAATTGATGTTTTCATAGT[T/C]
ATCTTGGAATATTTTCGATTTTATTTTTCTTTGATATGTTTTTCTATACGAAAATCAGCTGCAGTACCTCACTGTGGTAGTAATATAACGCTGCAGCACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.50% 36.10% 0.38% 0.00% NA
All Indica  2759 96.30% 3.70% 0.00% 0.00% NA
All Japonica  1512 2.40% 96.50% 1.06% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 95.50% 4.50% 0.00% 0.00% NA
Indica II  465 94.00% 6.00% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 95.20% 4.80% 0.00% 0.00% NA
Temperate Japonica  767 3.00% 94.90% 2.09% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 95.90% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 35.60% 62.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920361183 A -> G LOC_Os09g34930.1 downstream_gene_variant ; 2097.0bp to feature; MODIFIER silent_mutation Average:53.673; most accessible tissue: Callus, score: 79.451 N N N N
vg0920361183 A -> G LOC_Os09g34940.1 downstream_gene_variant ; 502.0bp to feature; MODIFIER silent_mutation Average:53.673; most accessible tissue: Callus, score: 79.451 N N N N
vg0920361183 A -> G LOC_Os09g34950.1 downstream_gene_variant ; 2766.0bp to feature; MODIFIER silent_mutation Average:53.673; most accessible tissue: Callus, score: 79.451 N N N N
vg0920361183 A -> G LOC_Os09g34940-LOC_Os09g34950 intergenic_region ; MODIFIER silent_mutation Average:53.673; most accessible tissue: Callus, score: 79.451 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920361183 NA 1.10E-06 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920361183 NA 4.19E-30 mr1333 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920361183 NA 7.26E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920361183 NA 8.36E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920361183 1.48E-08 2.84E-27 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920361183 2.67E-08 6.43E-12 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920361183 7.87E-09 1.43E-29 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920361183 2.42E-07 1.30E-12 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920361183 NA 6.79E-27 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920361183 NA 1.39E-07 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920361183 4.84E-06 4.84E-06 mr1528_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920361183 NA 2.19E-20 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920361183 3.52E-08 4.47E-31 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920361183 2.35E-11 2.64E-16 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251