Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920359641:

Variant ID: vg0920359641 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20359641
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


CTAGCAATGGGTAAGGTTGATGGTGGAGGCAACAATGGCATGGGAAAAATGGATAGCGGGGGGCACATTTACCGTTGCGCGACTTGGAAAAGAGGAGAGG[T/G]
GGGAGGTAGGGAGGGGAGGAGGCAAATCTAACGCCGACGAGATAAGGAAACAAGGGATGTAATGGTGCTATTGTACGAGGCGAGCGGCGGTGGATGAAAC

Reverse complement sequence

GTTTCATCCACCGCCGCTCGCCTCGTACAATAGCACCATTACATCCCTTGTTTCCTTATCTCGTCGGCGTTAGATTTGCCTCCTCCCCTCCCTACCTCCC[A/C]
CCTCTCCTCTTTTCCAAGTCGCGCAACGGTAAATGTGCCCCCCGCTATCCATTTTTCCCATGCCATTGTTGCCTCCACCATCAACCTTACCCATTGCTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.60% 36.00% 0.32% 0.04% NA
All Indica  2759 96.10% 3.80% 0.04% 0.07% NA
All Japonica  1512 2.80% 96.50% 0.73% 0.00% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 95.50% 4.50% 0.00% 0.00% NA
Indica II  465 94.00% 6.00% 0.00% 0.00% NA
Indica III  913 98.90% 1.00% 0.00% 0.11% NA
Indica Intermediate  786 94.70% 5.10% 0.13% 0.13% NA
Temperate Japonica  767 3.70% 94.90% 1.43% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 85.40% 1.04% 0.00% NA
Intermediate  90 38.90% 60.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920359641 T -> G LOC_Os09g34940.1 splice_donor_variant&intron_variant ; HIGH splice_donor_variant Average:65.705; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg0920359641 T -> DEL LOC_Os09g34940.1 N splice_donor_variant Average:65.705; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0920359641 T G -0.01 -0.01 0.0 -0.05 -0.04 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920359641 NA 1.06E-19 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920359641 NA 3.71E-06 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920359641 NA 7.78E-30 mr1333 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920359641 NA 1.03E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920359641 3.94E-08 1.62E-26 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920359641 1.67E-07 6.32E-10 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920359641 2.63E-09 4.65E-30 mr1676 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920359641 4.53E-07 2.13E-11 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920359641 NA 2.40E-26 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920359641 NA 4.43E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920359641 7.82E-06 NA mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920359641 NA 1.89E-19 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920359641 1.20E-08 6.95E-32 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920359641 1.82E-10 3.98E-15 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251