\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920324119:

Variant ID: vg0920324119 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20324119
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCCCATTATGCAGATGAATTTAAGTAACTAATTAAGTACGAAATCTGGAAAAAAAAATTGAGCTCTAACAGCAGACTCACCCTCTACCTGCGGCGAAC[A/G]
CAGGACAAATTTTTGGTGAGTGCTAATAGAATGAAGGTGGCAAACATAACATAAGAAGACTAAATATAATACGTGTAAATATATATGAGTATCTATTTGT

Reverse complement sequence

ACAAATAGATACTCATATATATTTACACGTATTATATTTAGTCTTCTTATGTTATGTTTGCCACCTTCATTCTATTAGCACTCACCAAAAATTTGTCCTG[T/C]
GTTCGCCGCAGGTAGAGGGTGAGTCTGCTGTTAGAGCTCAATTTTTTTTTCCAGATTTCGTACTTAATTAGTTACTTAAATTCATCTGCATAATGGGAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.50% 19.10% 2.33% 0.00% NA
All Indica  2759 97.40% 2.50% 0.11% 0.00% NA
All Japonica  1512 39.60% 53.60% 6.81% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.50% 3.50% 0.00% 0.00% NA
Indica II  465 95.30% 4.50% 0.22% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 3.20% 0.25% 0.00% NA
Temperate Japonica  767 13.80% 76.40% 9.78% 0.00% NA
Tropical Japonica  504 73.00% 24.20% 2.78% 0.00% NA
Japonica Intermediate  241 51.90% 42.30% 5.81% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 68.90% 27.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920324119 A -> G LOC_Os09g34880.1 upstream_gene_variant ; 2448.0bp to feature; MODIFIER silent_mutation Average:55.707; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N
vg0920324119 A -> G LOC_Os09g34860.1 downstream_gene_variant ; 2984.0bp to feature; MODIFIER silent_mutation Average:55.707; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N
vg0920324119 A -> G LOC_Os09g34870.1 intron_variant ; MODIFIER silent_mutation Average:55.707; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920324119 NA 2.36E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0920324119 NA 4.01E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119 NA 5.10E-07 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119 NA 6.61E-07 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119 NA 2.42E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119 NA 1.86E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119 NA 7.16E-08 mr1482 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119 NA 3.22E-08 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119 NA 2.77E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119 NA 1.44E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119 NA 1.28E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119 NA 2.16E-21 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119 NA 1.06E-07 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119 NA 6.01E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251