Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920324119:

Variant ID: vg0920324119 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 20324119
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

ATTCCCATTATGCAGATGAATTTAAGTAACTAATTAAGTACGAAATCTGGAAAAAAAAATTGAGCTCTAACAGCAGACTCACCCTCTACCTGCGGCGAAC[A/G]
CAGGACAAATTTTTGGTGAGTGCTAATAGAATGAAGGTGGCAAACATAACATAAGAAGACTAAATATAATACGTGTAAATATATATGAGTATCTATTTGT

Reverse complement sequence

ACAAATAGATACTCATATATATTTACACGTATTATATTTAGTCTTCTTATGTTATGTTTGCCACCTTCATTCTATTAGCACTCACCAAAAATTTGTCCTG[T/C]
GTTCGCCGCAGGTAGAGGGTGAGTCTGCTGTTAGAGCTCAATTTTTTTTTCCAGATTTCGTACTTAATTAGTTACTTAAATTCATCTGCATAATGGGAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.50%	19.10%	2.33%	0.00%	NA
All Indica	2759	97.40%	2.50%	0.11%	0.00%	NA
All Japonica	1512	39.60%	53.60%	6.81%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	96.50%	3.50%	0.00%	0.00%	NA
Indica II	465	95.30%	4.50%	0.22%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	96.60%	3.20%	0.25%	0.00%	NA
Temperate Japonica	767	13.80%	76.40%	9.78%	0.00%	NA
Tropical Japonica	504	73.00%	24.20%	2.78%	0.00%	NA
Japonica Intermediate	241	51.90%	42.30%	5.81%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	68.90%	27.80%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0920324119	A -> G	LOC_Os09g34880.1	upstream_gene_variant ; 2448.0bp to feature; MODIFIER	silent_mutation	Average:55.707; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N
vg0920324119	A -> G	LOC_Os09g34860.1	downstream_gene_variant ; 2984.0bp to feature; MODIFIER	silent_mutation	Average:55.707; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N
vg0920324119	A -> G	LOC_Os09g34870.1	intron_variant ; MODIFIER	silent_mutation	Average:55.707; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0920324119	NA	2.36E-11	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0920324119	NA	4.01E-06	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119	NA	5.10E-07	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119	NA	6.61E-07	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119	NA	2.42E-08	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119	NA	1.86E-07	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119	NA	7.16E-08	mr1482	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119	NA	3.22E-08	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119	NA	2.77E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119	NA	1.44E-06	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119	NA	1.28E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119	NA	2.16E-21	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119	NA	1.06E-07	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920324119	NA	6.01E-13	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251