\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920309583:

Variant ID: vg0920309583 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20309583
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTATTTTAGTAAATTTATGCACCTAAAGTTTATACACCTTAAGTTTACACATCTAAAGTTTAGAGACTAAAAGGTTATAAGTCAAAAGTTTATATATCC[G/A]
ATTCAAATTTGAATTTGAATTCAAATATTTTTTATATATAGTATTTCTATACATCTAAAGTTTATAGATCTAAAGTTTATAGACCTAAAGTTTATATATC

Reverse complement sequence

GATATATAAACTTTAGGTCTATAAACTTTAGATCTATAAACTTTAGATGTATAGAAATACTATATATAAAAAATATTTGAATTCAAATTCAAATTTGAAT[C/T]
GGATATATAAACTTTTGACTTATAACCTTTTAGTCTCTAAACTTTAGATGTGTAAACTTAAGGTGTATAAACTTTAGGTGCATAAATTTACTAAAATAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.50% 8.90% 7.26% 20.33% NA
All Indica  2759 49.10% 15.00% 9.17% 26.71% NA
All Japonica  1512 98.30% 0.00% 1.52% 0.20% NA
Aus  269 9.70% 0.40% 10.41% 79.55% NA
Indica I  595 84.50% 0.50% 5.55% 9.41% NA
Indica II  465 80.20% 1.90% 10.11% 7.74% NA
Indica III  913 12.60% 25.00% 11.50% 50.93% NA
Indica Intermediate  786 46.20% 22.30% 8.65% 22.90% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 0.00% 1.98% 0.20% NA
Japonica Intermediate  241 93.80% 0.00% 5.39% 0.83% NA
VI/Aromatic  96 66.70% 0.00% 31.25% 2.08% NA
Intermediate  90 78.90% 5.60% 10.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920309583 G -> DEL N N silent_mutation Average:45.602; most accessible tissue: Zhenshan97 flower, score: 85.314 N N N N
vg0920309583 G -> A LOC_Os09g34847.1 downstream_gene_variant ; 1244.0bp to feature; MODIFIER silent_mutation Average:45.602; most accessible tissue: Zhenshan97 flower, score: 85.314 N N N N
vg0920309583 G -> A LOC_Os09g34850.1 downstream_gene_variant ; 3984.0bp to feature; MODIFIER silent_mutation Average:45.602; most accessible tissue: Zhenshan97 flower, score: 85.314 N N N N
vg0920309583 G -> A LOC_Os09g34847.2 downstream_gene_variant ; 1415.0bp to feature; MODIFIER silent_mutation Average:45.602; most accessible tissue: Zhenshan97 flower, score: 85.314 N N N N
vg0920309583 G -> A LOC_Os09g34850.3 downstream_gene_variant ; 3984.0bp to feature; MODIFIER silent_mutation Average:45.602; most accessible tissue: Zhenshan97 flower, score: 85.314 N N N N
vg0920309583 G -> A LOC_Os09g34850.2 downstream_gene_variant ; 3984.0bp to feature; MODIFIER silent_mutation Average:45.602; most accessible tissue: Zhenshan97 flower, score: 85.314 N N N N
vg0920309583 G -> A LOC_Os09g34847-LOC_Os09g34850 intergenic_region ; MODIFIER silent_mutation Average:45.602; most accessible tissue: Zhenshan97 flower, score: 85.314 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920309583 NA 1.13E-11 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 4.05E-11 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 3.24E-11 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 9.73E-12 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 2.47E-10 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 2.56E-11 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 9.35E-09 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 1.25E-09 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 5.72E-09 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 4.27E-09 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 1.90E-11 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 3.93E-07 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 3.24E-06 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 5.35E-09 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 7.65E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 2.27E-11 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 1.01E-08 NA mr1065_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 2.68E-09 1.19E-16 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 4.53E-06 6.15E-14 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 3.35E-06 NA mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 2.38E-06 1.79E-13 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 2.58E-06 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 5.10E-06 5.25E-14 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 1.98E-09 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 9.49E-12 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 2.96E-10 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 5.31E-06 NA mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 8.90E-11 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 1.79E-12 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 3.43E-11 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 1.26E-11 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 5.04E-06 6.13E-13 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 2.53E-09 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 2.27E-07 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 7.49E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 2.74E-09 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 1.07E-06 NA mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 3.98E-06 4.69E-11 mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 2.91E-08 NA mr1244_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 7.32E-09 9.86E-16 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 9.15E-08 mr1954_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583 NA 1.41E-07 mr1954_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251