Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920309583:

Variant ID: vg0920309583 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 20309583
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTATTTTAGTAAATTTATGCACCTAAAGTTTATACACCTTAAGTTTACACATCTAAAGTTTAGAGACTAAAAGGTTATAAGTCAAAAGTTTATATATCC[G/A]
ATTCAAATTTGAATTTGAATTCAAATATTTTTTATATATAGTATTTCTATACATCTAAAGTTTATAGATCTAAAGTTTATAGACCTAAAGTTTATATATC

Reverse complement sequence

GATATATAAACTTTAGGTCTATAAACTTTAGATCTATAAACTTTAGATGTATAGAAATACTATATATAAAAAATATTTGAATTCAAATTCAAATTTGAAT[C/T]
GGATATATAAACTTTTGACTTATAACCTTTTAGTCTCTAAACTTTAGATGTGTAAACTTAAGGTGTATAAACTTTAGGTGCATAAATTTACTAAAATAGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.50%	8.90%	7.26%	20.33%	NA
All Indica	2759	49.10%	15.00%	9.17%	26.71%	NA
All Japonica	1512	98.30%	0.00%	1.52%	0.20%	NA
Aus	269	9.70%	0.40%	10.41%	79.55%	NA
Indica I	595	84.50%	0.50%	5.55%	9.41%	NA
Indica II	465	80.20%	1.90%	10.11%	7.74%	NA
Indica III	913	12.60%	25.00%	11.50%	50.93%	NA
Indica Intermediate	786	46.20%	22.30%	8.65%	22.90%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	97.80%	0.00%	1.98%	0.20%	NA
Japonica Intermediate	241	93.80%	0.00%	5.39%	0.83%	NA
VI/Aromatic	96	66.70%	0.00%	31.25%	2.08%	NA
Intermediate	90	78.90%	5.60%	10.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0920309583	G -> DEL	N	N	silent_mutation	Average:45.602; most accessible tissue: Zhenshan97 flower, score: 85.314	N	N	N	N
vg0920309583	G -> A	LOC_Os09g34847.1	downstream_gene_variant ; 1244.0bp to feature; MODIFIER	silent_mutation	Average:45.602; most accessible tissue: Zhenshan97 flower, score: 85.314	N	N	N	N
vg0920309583	G -> A	LOC_Os09g34850.1	downstream_gene_variant ; 3984.0bp to feature; MODIFIER	silent_mutation	Average:45.602; most accessible tissue: Zhenshan97 flower, score: 85.314	N	N	N	N
vg0920309583	G -> A	LOC_Os09g34847.2	downstream_gene_variant ; 1415.0bp to feature; MODIFIER	silent_mutation	Average:45.602; most accessible tissue: Zhenshan97 flower, score: 85.314	N	N	N	N
vg0920309583	G -> A	LOC_Os09g34850.3	downstream_gene_variant ; 3984.0bp to feature; MODIFIER	silent_mutation	Average:45.602; most accessible tissue: Zhenshan97 flower, score: 85.314	N	N	N	N
vg0920309583	G -> A	LOC_Os09g34850.2	downstream_gene_variant ; 3984.0bp to feature; MODIFIER	silent_mutation	Average:45.602; most accessible tissue: Zhenshan97 flower, score: 85.314	N	N	N	N
vg0920309583	G -> A	LOC_Os09g34847-LOC_Os09g34850	intergenic_region ; MODIFIER	silent_mutation	Average:45.602; most accessible tissue: Zhenshan97 flower, score: 85.314	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0920309583	NA	1.13E-11	mr1065	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	4.05E-11	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	3.24E-11	mr1078	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	9.73E-12	mr1091	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	2.47E-10	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	2.56E-11	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	9.35E-09	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	1.25E-09	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	5.72E-09	mr1112	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	4.27E-09	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	1.90E-11	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	3.93E-07	mr1200	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	3.24E-06	mr1218	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	5.35E-09	mr1234	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	7.65E-07	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	2.27E-11	mr1244	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	1.01E-08	NA	mr1065_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	2.68E-09	1.19E-16	mr1065_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	4.53E-06	6.15E-14	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	3.35E-06	NA	mr1078_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	2.38E-06	1.79E-13	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	2.58E-06	NA	mr1091_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	5.10E-06	5.25E-14	mr1091_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	1.98E-09	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	9.49E-12	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	2.96E-10	mr1108_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	5.31E-06	NA	mr1110_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	8.90E-11	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	1.79E-12	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	3.43E-11	mr1112_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	1.26E-11	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	5.04E-06	6.13E-13	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	2.53E-09	mr1200_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	2.27E-07	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	7.49E-06	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	2.74E-09	mr1218_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	1.07E-06	NA	mr1234_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	3.98E-06	4.69E-11	mr1234_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	2.91E-08	NA	mr1244_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	7.32E-09	9.86E-16	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	9.15E-08	mr1954_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309583	NA	1.41E-07	mr1954_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251