Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920309441:

Variant ID: vg0920309441 (JBrowse)	Variation Type: INDEL
Chromosome: chr09	Position: 20309441
Reference Allele: T	Alternative Allele: TCC,C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAACAAACGGTAGGGCGCCGCGAAGCGGGGTACCCCTAATGGGCGATCGATCGCCGTGGGGATGGGGTAGCGATCAGATTCGCTCCCCACCTCCCCCCTC[T/TCC,C]
CTTCCTTCACCTGGTTTTCTTTTTTGGCATCGCATTACTTTCCTATTTTAGTAAATTTATGCACCTAAAGTTTATACACCTTAAGTTTACACATCTAAAG

Reverse complement sequence

CTTTAGATGTGTAAACTTAAGGTGTATAAACTTTAGGTGCATAAATTTACTAAAATAGGAAAGTAATGCGATGCCAAAAAAGAAAACCAGGTGAAGGAAG[A/GGA,G]
GAGGGGGGAGGTGGGGAGCGAATCTGATCGCTACCCCATCCCCACGGCGATCGATCGCCCATTAGGGGTACCCCGCTTCGCGGCGCCCTACCGTTTGTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.40%	7.50%	27.34%	27.97%	TCC: 0.80%
All Indica	2759	4.10%	12.50%	40.30%	41.75%	TCC: 1.38%
All Japonica	1512	98.00%	0.20%	1.65%	0.13%	NA
Aus	269	2.20%	0.70%	40.15%	56.88%	NA
Indica I	595	4.90%	11.30%	45.04%	38.82%	NA
Indica II	465	6.00%	17.40%	45.16%	30.97%	TCC: 0.43%
Indica III	913	1.60%	9.90%	31.65%	54.55%	TCC: 2.30%
Indica Intermediate	786	5.20%	13.50%	43.89%	35.50%	TCC: 1.91%
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	97.60%	0.20%	2.18%	0.00%	NA
Japonica Intermediate	241	92.90%	0.40%	5.81%	0.83%	NA
VI/Aromatic	96	65.60%	0.00%	29.17%	5.21%	NA
Intermediate	90	60.00%	7.80%	21.11%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0920309441	T -> DEL	N	N	silent_mutation	Average:63.652; most accessible tissue: Zhenshan97 flower, score: 89.594	N	N	N	N
vg0920309441	T -> TCC	LOC_Os09g34847.1	downstream_gene_variant ; 1103.0bp to feature; MODIFIER	silent_mutation	Average:63.652; most accessible tissue: Zhenshan97 flower, score: 89.594	N	N	N	N
vg0920309441	T -> TCC	LOC_Os09g34850.1	downstream_gene_variant ; 4125.0bp to feature; MODIFIER	silent_mutation	Average:63.652; most accessible tissue: Zhenshan97 flower, score: 89.594	N	N	N	N
vg0920309441	T -> TCC	LOC_Os09g34847.2	downstream_gene_variant ; 1274.0bp to feature; MODIFIER	silent_mutation	Average:63.652; most accessible tissue: Zhenshan97 flower, score: 89.594	N	N	N	N
vg0920309441	T -> TCC	LOC_Os09g34850.3	downstream_gene_variant ; 4125.0bp to feature; MODIFIER	silent_mutation	Average:63.652; most accessible tissue: Zhenshan97 flower, score: 89.594	N	N	N	N
vg0920309441	T -> TCC	LOC_Os09g34850.2	downstream_gene_variant ; 4125.0bp to feature; MODIFIER	silent_mutation	Average:63.652; most accessible tissue: Zhenshan97 flower, score: 89.594	N	N	N	N
vg0920309441	T -> TCC	LOC_Os09g34847-LOC_Os09g34850	intergenic_region ; MODIFIER	silent_mutation	Average:63.652; most accessible tissue: Zhenshan97 flower, score: 89.594	N	N	N	N
vg0920309441	T -> C	LOC_Os09g34847.1	downstream_gene_variant ; 1102.0bp to feature; MODIFIER	silent_mutation	Average:63.652; most accessible tissue: Zhenshan97 flower, score: 89.594	N	N	N	N
vg0920309441	T -> C	LOC_Os09g34850.1	downstream_gene_variant ; 4126.0bp to feature; MODIFIER	silent_mutation	Average:63.652; most accessible tissue: Zhenshan97 flower, score: 89.594	N	N	N	N
vg0920309441	T -> C	LOC_Os09g34847.2	downstream_gene_variant ; 1273.0bp to feature; MODIFIER	silent_mutation	Average:63.652; most accessible tissue: Zhenshan97 flower, score: 89.594	N	N	N	N
vg0920309441	T -> C	LOC_Os09g34850.3	downstream_gene_variant ; 4126.0bp to feature; MODIFIER	silent_mutation	Average:63.652; most accessible tissue: Zhenshan97 flower, score: 89.594	N	N	N	N
vg0920309441	T -> C	LOC_Os09g34850.2	downstream_gene_variant ; 4126.0bp to feature; MODIFIER	silent_mutation	Average:63.652; most accessible tissue: Zhenshan97 flower, score: 89.594	N	N	N	N
vg0920309441	T -> C	LOC_Os09g34847-LOC_Os09g34850	intergenic_region ; MODIFIER	silent_mutation	Average:63.652; most accessible tissue: Zhenshan97 flower, score: 89.594	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0920309441	T	C	0.02	0.01	0.01	0.01	0.02	0.02
vg0920309441	T	TCC	0.07	0.12	0.09	0.06	0.13	0.23

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0920309441	NA	7.26E-103	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	4.42E-101	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	8.47E-06	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	1.51E-15	mr1276	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	3.71E-10	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	3.96E-16	mr1323	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	5.04E-16	mr1324	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	4.36E-11	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	1.52E-13	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	2.85E-31	mr1333	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	5.93E-13	mr1335	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	1.64E-07	mr1410	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	9.52E-23	mr1518	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	2.52E-08	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	4.04E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	1.26E-10	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	1.72E-24	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	3.13E-09	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	6.59E-27	mr1686	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	5.09E-07	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	7.37E-12	mr1940	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	1.78E-35	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	3.46E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	3.31E-06	NA	mr1622_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	3.95E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	3.37E-18	mr1657_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	2.10E-08	9.15E-29	mr1676_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	4.82E-08	1.20E-13	mr1676_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920309441	NA	4.74E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251