\
| Variant ID: vg0920306905 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 20306905 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.06, others allele: 0.00, population size: 36. )
ATTTTCTACTATTTGTTGGTGAAAAAATGAGGCTACCATTCTCCTCCTGCAAAATAAATCAGGGTAGCGATGCAGTCTATATATAAATAAGTGTATGCTT[C/T]
CCATATTCCAATCCTTGTGACCTAGATAATGCCAAACAAATTCATCGTCATTTTCTCATGCAATATATTGCCATCACCTCCGTGCAGCATGTCGATTTCT
AGAAATCGACATGCTGCACGGAGGTGATGGCAATATATTGCATGAGAAAATGACGATGAATTTGTTTGGCATTATCTAGGTCACAAGGATTGGAATATGG[G/A]
AAGCATACACTTATTTATATATAGACTGCATCGCTACCCTGATTTATTTTGCAGGAGGAGAATGGTAGCCTCATTTTTTCACCAACAAATAGTAGAAAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.30% | 23.50% | 3.47% | 24.78% | NA |
| All Indica | 2759 | 24.00% | 39.60% | 4.46% | 31.93% | NA |
| All Japonica | 1512 | 98.00% | 0.10% | 0.73% | 1.12% | NA |
| Aus | 269 | 4.80% | 0.70% | 5.58% | 88.85% | NA |
| Indica I | 595 | 8.70% | 72.80% | 3.53% | 14.96% | NA |
| Indica II | 465 | 11.00% | 68.60% | 4.09% | 16.34% | NA |
| Indica III | 913 | 31.30% | 8.00% | 5.26% | 55.42% | NA |
| Indica Intermediate | 786 | 34.70% | 34.10% | 4.45% | 26.72% | NA |
| Temperate Japonica | 767 | 99.60% | 0.10% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 97.80% | 0.00% | 0.79% | 1.39% | NA |
| Japonica Intermediate | 241 | 93.40% | 0.40% | 2.90% | 3.32% | NA |
| VI/Aromatic | 96 | 66.70% | 3.10% | 9.38% | 20.83% | NA |
| Intermediate | 90 | 67.80% | 10.00% | 6.67% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0920306905 | C -> DEL | N | N | silent_mutation | Average:63.65; most accessible tissue: Zhenshan97 panicle, score: 78.302 | N | N | N | N |
| vg0920306905 | C -> T | LOC_Os09g34847.1 | 3_prime_UTR_variant ; 335.0bp to feature; MODIFIER | silent_mutation | Average:63.65; most accessible tissue: Zhenshan97 panicle, score: 78.302 | N | N | N | N |
| vg0920306905 | C -> T | LOC_Os09g34847.2 | 3_prime_UTR_variant ; 335.0bp to feature; MODIFIER | silent_mutation | Average:63.65; most accessible tissue: Zhenshan97 panicle, score: 78.302 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0920306905 | NA | 3.61E-09 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 4.83E-07 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 9.24E-07 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 1.38E-08 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 5.07E-09 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 5.87E-08 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 2.30E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 2.99E-15 | mr1218 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | 3.54E-07 | NA | mr1244 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | 1.34E-07 | 2.59E-14 | mr1244 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 1.19E-08 | mr1302 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 1.92E-19 | mr1518 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 6.72E-22 | mr1676 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 4.77E-07 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 3.30E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | 6.16E-06 | NA | mr1065_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | 9.85E-06 | 2.14E-14 | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 6.64E-14 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 3.61E-10 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 5.20E-08 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 9.24E-11 | mr1091_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 8.06E-09 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 1.46E-10 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 4.43E-10 | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 1.35E-07 | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 1.94E-12 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 2.13E-09 | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 6.04E-10 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 9.04E-12 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 9.53E-09 | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 3.03E-08 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | 4.32E-09 | NA | mr1244_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | 1.82E-08 | 2.29E-16 | mr1244_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | 4.69E-07 | 7.54E-28 | mr1676_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | 8.55E-06 | 1.08E-09 | mr1676_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920306905 | NA | 1.95E-07 | mr1877_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |