\
| Variant ID: vg0920292378 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 20292378 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TGGGCCCTTTTGGATCGCAGAATTAAAATTACGATTTTGCTATATCTCACTCGAAAGATTTTTTCTTATCTCTCACTCGATTTTCTTACTCAAATTTACA[A/G]
TGTATTTTCTTGTAAGTTACAGTGTAATTTATGAAACTTACACTGTAACTTTTGTAAGTTACACTGTAATTTTTAAATCTTCACATGTAAATTTTAAATT
AATTTAAAATTTACATGTGAAGATTTAAAAATTACAGTGTAACTTACAAAAGTTACAGTGTAAGTTTCATAAATTACACTGTAACTTACAAGAAAATACA[T/C]
TGTAAATTTGAGTAAGAAAATCGAGTGAGAGATAAGAAAAAATCTTTCGAGTGAGATATAGCAAAATCGTAATTTTAATTCTGCGATCCAAAAGGGCCCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.00% | 1.10% | 7.38% | 55.52% | NA |
| All Indica | 2759 | 4.50% | 0.80% | 9.06% | 85.65% | NA |
| All Japonica | 1512 | 96.50% | 1.50% | 1.65% | 0.33% | NA |
| Aus | 269 | 1.90% | 0.70% | 15.61% | 81.78% | NA |
| Indica I | 595 | 5.50% | 0.30% | 8.74% | 85.38% | NA |
| Indica II | 465 | 6.50% | 1.50% | 9.25% | 82.80% | NA |
| Indica III | 913 | 1.50% | 1.00% | 8.43% | 89.05% | NA |
| Indica Intermediate | 786 | 5.90% | 0.60% | 9.92% | 83.59% | NA |
| Temperate Japonica | 767 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.00% | 2.40% | 2.18% | 0.40% | NA |
| Japonica Intermediate | 241 | 92.50% | 0.40% | 5.81% | 1.24% | NA |
| VI/Aromatic | 96 | 59.40% | 6.20% | 25.00% | 9.38% | NA |
| Intermediate | 90 | 61.10% | 0.00% | 8.89% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0920292378 | A -> G | LOC_Os09g34340-LOC_Os09g34847 | intergenic_region ; MODIFIER | silent_mutation | Average:19.21; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0920292378 | A -> DEL | N | N | silent_mutation | Average:19.21; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0920292378 | 4.46E-06 | NA | mr1062 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920292378 | NA | 4.17E-06 | mr1216 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920292378 | NA | 5.04E-09 | mr1410 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920292378 | NA | 3.51E-07 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920292378 | 2.16E-07 | 9.32E-27 | mr1518 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920292378 | 9.69E-09 | 1.04E-12 | mr1518 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920292378 | 5.19E-07 | 4.28E-29 | mr1676 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920292378 | 6.06E-09 | 4.09E-14 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920292378 | NA | 6.95E-29 | mr1676_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920292378 | 3.43E-10 | 2.00E-17 | mr1676_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |