\
| Variant ID: vg0920248805 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 20248805 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 109. )
TTTTGATAGGAATGTAAATGTAAACAGATGATTGTAAAACGCAGGAAAAATATAGGAATGACCGTTTTATTAAACCGTAAGAAAAACGTATAAATTGGAT[G/A]
AGAGAGATAGACTCAAAGGAAAGTTACCAAGAGGTTGAAGCTGTTGCTAAATTTCCTCTAAAATCTCTATAGGATTGTTCATTTTCTAGGAATTTTAAAA
TTTTAAAATTCCTAGAAAATGAACAATCCTATAGAGATTTTAGAGGAAATTTAGCAACAGCTTCAACCTCTTGGTAACTTTCCTTTGAGTCTATCTCTCT[C/T]
ATCCAATTTATACGTTTTTCTTACGGTTTAATAAAACGGTCATTCCTATATTTTTCCTGCGTTTTACAATCATCTGTTTACATTTACATTCCTATCAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.30% | 7.00% | 3.62% | 0.00% | NA |
| All Indica | 2759 | 82.00% | 11.90% | 6.09% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.20% | 0.00% | 12.77% | 0.00% | NA |
| Indica II | 465 | 49.70% | 39.10% | 11.18% | 0.00% | NA |
| Indica III | 913 | 92.40% | 6.90% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 85.10% | 10.60% | 4.33% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 3.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0920248805 | G -> A | LOC_Os09g34300.1 | upstream_gene_variant ; 277.0bp to feature; MODIFIER | silent_mutation | Average:62.114; most accessible tissue: Callus, score: 92.853 | N | N | N | N |
| vg0920248805 | G -> A | LOC_Os09g34310.1 | upstream_gene_variant ; 3507.0bp to feature; MODIFIER | silent_mutation | Average:62.114; most accessible tissue: Callus, score: 92.853 | N | N | N | N |
| vg0920248805 | G -> A | LOC_Os09g34310.3 | upstream_gene_variant ; 3468.0bp to feature; MODIFIER | silent_mutation | Average:62.114; most accessible tissue: Callus, score: 92.853 | N | N | N | N |
| vg0920248805 | G -> A | LOC_Os09g34310.2 | upstream_gene_variant ; 3475.0bp to feature; MODIFIER | silent_mutation | Average:62.114; most accessible tissue: Callus, score: 92.853 | N | N | N | N |
| vg0920248805 | G -> A | LOC_Os09g34300-LOC_Os09g34310 | intergenic_region ; MODIFIER | silent_mutation | Average:62.114; most accessible tissue: Callus, score: 92.853 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0920248805 | NA | 7.91E-08 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920248805 | NA | 1.53E-07 | mr1232 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920248805 | 5.67E-06 | 9.42E-13 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920248805 | 2.29E-06 | NA | mr1598 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920248805 | NA | 1.96E-09 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920248805 | NA | 8.49E-06 | mr1944 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920248805 | NA | 1.71E-09 | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920248805 | NA | 4.39E-07 | mr1174_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920248805 | NA | 1.16E-07 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920248805 | NA | 9.37E-08 | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920248805 | NA | 3.05E-07 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920248805 | NA | 2.50E-11 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920248805 | NA | 6.61E-10 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920248805 | NA | 1.07E-08 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |