\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920248805:

Variant ID: vg0920248805 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20248805
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTGATAGGAATGTAAATGTAAACAGATGATTGTAAAACGCAGGAAAAATATAGGAATGACCGTTTTATTAAACCGTAAGAAAAACGTATAAATTGGAT[G/A]
AGAGAGATAGACTCAAAGGAAAGTTACCAAGAGGTTGAAGCTGTTGCTAAATTTCCTCTAAAATCTCTATAGGATTGTTCATTTTCTAGGAATTTTAAAA

Reverse complement sequence

TTTTAAAATTCCTAGAAAATGAACAATCCTATAGAGATTTTAGAGGAAATTTAGCAACAGCTTCAACCTCTTGGTAACTTTCCTTTGAGTCTATCTCTCT[C/T]
ATCCAATTTATACGTTTTTCTTACGGTTTAATAAAACGGTCATTCCTATATTTTTCCTGCGTTTTACAATCATCTGTTTACATTTACATTCCTATCAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.30% 7.00% 3.62% 0.00% NA
All Indica  2759 82.00% 11.90% 6.09% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 87.20% 0.00% 12.77% 0.00% NA
Indica II  465 49.70% 39.10% 11.18% 0.00% NA
Indica III  913 92.40% 6.90% 0.66% 0.00% NA
Indica Intermediate  786 85.10% 10.60% 4.33% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 3.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920248805 G -> A LOC_Os09g34300.1 upstream_gene_variant ; 277.0bp to feature; MODIFIER silent_mutation Average:62.114; most accessible tissue: Callus, score: 92.853 N N N N
vg0920248805 G -> A LOC_Os09g34310.1 upstream_gene_variant ; 3507.0bp to feature; MODIFIER silent_mutation Average:62.114; most accessible tissue: Callus, score: 92.853 N N N N
vg0920248805 G -> A LOC_Os09g34310.3 upstream_gene_variant ; 3468.0bp to feature; MODIFIER silent_mutation Average:62.114; most accessible tissue: Callus, score: 92.853 N N N N
vg0920248805 G -> A LOC_Os09g34310.2 upstream_gene_variant ; 3475.0bp to feature; MODIFIER silent_mutation Average:62.114; most accessible tissue: Callus, score: 92.853 N N N N
vg0920248805 G -> A LOC_Os09g34300-LOC_Os09g34310 intergenic_region ; MODIFIER silent_mutation Average:62.114; most accessible tissue: Callus, score: 92.853 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920248805 NA 7.91E-08 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920248805 NA 1.53E-07 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920248805 5.67E-06 9.42E-13 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920248805 2.29E-06 NA mr1598 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920248805 NA 1.96E-09 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920248805 NA 8.49E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920248805 NA 1.71E-09 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920248805 NA 4.39E-07 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920248805 NA 1.16E-07 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920248805 NA 9.37E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920248805 NA 3.05E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920248805 NA 2.50E-11 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920248805 NA 6.61E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920248805 NA 1.07E-08 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251