\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920234916:

Variant ID: vg0920234916 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20234916
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCCAAGGGATATTTTTTAGTCCTTCCTCAAATAGTCCAAATAGCCCAAAAAGATCCAAAATAGTGAGCTATTTGAGAGCTATTTGGAAATAACCCATCC[C/T]
AAAACTATCCCACCTAAGGGGTGCTAATTGAGTAATTGGGGCTATTTCGGGTGAGGCCCACTGAAAAAATGTCTTCTCTCTCCATGGGAAGGTACATTAA

Reverse complement sequence

TTAATGTACCTTCCCATGGAGAGAGAAGACATTTTTTCAGTGGGCCTCACCCGAAATAGCCCCAATTACTCAATTAGCACCCCTTAGGTGGGATAGTTTT[G/A]
GGATGGGTTATTTCCAAATAGCTCTCAAATAGCTCACTATTTTGGATCTTTTTGGGCTATTTGGACTATTTGAGGAAGGACTAAAAAATATCCCTTGGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.00% 38.30% 0.19% 6.52% NA
All Indica  2759 91.70% 4.00% 0.07% 4.20% NA
All Japonica  1512 0.50% 98.30% 0.00% 1.19% NA
Aus  269 7.80% 39.40% 1.12% 51.67% NA
Indica I  595 88.70% 3.70% 0.00% 7.56% NA
Indica II  465 93.80% 5.40% 0.00% 0.86% NA
Indica III  913 95.10% 1.40% 0.00% 3.50% NA
Indica Intermediate  786 88.90% 6.40% 0.25% 4.45% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 97.60% 0.00% 1.98% NA
Japonica Intermediate  241 1.70% 95.00% 0.00% 3.32% NA
VI/Aromatic  96 10.40% 52.10% 3.12% 34.38% NA
Intermediate  90 33.30% 63.30% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920234916 C -> DEL N N silent_mutation Average:73.466; most accessible tissue: Zhenshan97 flag leaf, score: 90.181 N N N N
vg0920234916 C -> T LOC_Os09g34280.1 upstream_gene_variant ; 1541.0bp to feature; MODIFIER silent_mutation Average:73.466; most accessible tissue: Zhenshan97 flag leaf, score: 90.181 N N N N
vg0920234916 C -> T LOC_Os09g34280.2 upstream_gene_variant ; 1503.0bp to feature; MODIFIER silent_mutation Average:73.466; most accessible tissue: Zhenshan97 flag leaf, score: 90.181 N N N N
vg0920234916 C -> T LOC_Os09g34280.3 upstream_gene_variant ; 1541.0bp to feature; MODIFIER silent_mutation Average:73.466; most accessible tissue: Zhenshan97 flag leaf, score: 90.181 N N N N
vg0920234916 C -> T LOC_Os09g34280.4 upstream_gene_variant ; 1541.0bp to feature; MODIFIER silent_mutation Average:73.466; most accessible tissue: Zhenshan97 flag leaf, score: 90.181 N N N N
vg0920234916 C -> T LOC_Os09g34270.1 downstream_gene_variant ; 965.0bp to feature; MODIFIER silent_mutation Average:73.466; most accessible tissue: Zhenshan97 flag leaf, score: 90.181 N N N N
vg0920234916 C -> T LOC_Os09g34270-LOC_Os09g34280 intergenic_region ; MODIFIER silent_mutation Average:73.466; most accessible tissue: Zhenshan97 flag leaf, score: 90.181 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0920234916 C T -0.02 -0.04 -0.03 -0.01 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920234916 NA 2.98E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920234916 NA 1.17E-11 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920234916 NA 7.37E-14 mr1151 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920234916 4.20E-06 4.20E-06 mr1151 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920234916 NA 8.69E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920234916 NA 5.20E-15 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920234916 NA 6.35E-12 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920234916 NA 9.94E-08 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920234916 2.25E-09 9.14E-10 mr1216 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920234916 4.46E-08 3.56E-13 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920234916 NA 2.71E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920234916 NA 9.73E-10 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920234916 NA 5.40E-16 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920234916 NA 7.16E-07 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920234916 NA 1.50E-08 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920234916 NA 4.58E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920234916 NA 1.15E-30 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920234916 NA 1.13E-08 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920234916 NA 2.38E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920234916 NA 1.95E-08 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920234916 NA 2.90E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920234916 NA 1.63E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920234916 NA 3.31E-47 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251