Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920193283:

Variant ID: vg0920193283 (JBrowse)	Variation Type: INDEL
Chromosome: chr09	Position: 20193283
Reference Allele: T	Alternative Allele: C,TCTATCC
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGTATTATAAATATTACTCCATCCATCTAATTTTGATTGGCATATTTCCAAATCTGAAAAATTACTTTTGATAGATATATTTCAATCCAACCACCTATC[T/C,TCTATCC]
TTTTAATGACTTTCTCAGATTGGTAACATGGACATCGAGAAATGTAAACATTAATGAATGACTTAGGTACGAGGAATAACTATTAGCCTGTTTAAATGGA

Reverse complement sequence

TCCATTTAAACAGGCTAATAGTTATTCCTCGTACCTAAGTCATTCATTAATGTTTACATTTCTCGATGTCCATGTTACCAATCTGAGAAAGTCATTAAAA[A/G,GGATAGA]
GATAGGTGGTTGGATTGAAATATATCTATCAAAAGTAATTTTTCAGATTTGGAAATATGCCAATCAAAATTAGATGGATGGAGTAATATTTATAATACTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.50%	28.80%	17.54%	17.18%	TCTATCC: 0.91%
All Indica	2759	3.60%	48.60%	29.03%	17.47%	TCTATCC: 1.34%
All Japonica	1512	97.90%	0.30%	0.20%	1.59%	NA
Aus	269	0.70%	0.40%	3.72%	95.17%	NA
Indica I	595	4.90%	40.20%	41.34%	13.61%	NA
Indica II	465	5.80%	42.40%	34.19%	17.20%	TCTATCC: 0.43%
Indica III	913	0.70%	58.50%	18.51%	20.15%	TCTATCC: 2.19%
Indica Intermediate	786	4.60%	47.20%	28.88%	17.43%	TCTATCC: 1.91%
Temperate Japonica	767	99.70%	0.10%	0.13%	0.00%	NA
Tropical Japonica	504	97.60%	0.20%	0.00%	2.18%	NA
Japonica Intermediate	241	92.90%	0.80%	0.83%	5.39%	NA
VI/Aromatic	96	50.00%	1.00%	5.21%	41.67%	TCTATCC: 2.08%
Intermediate	90	55.60%	17.80%	11.11%	11.11%	TCTATCC: 4.44%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0920193283	T -> DEL	N	N	silent_mutation	Average:35.391; most accessible tissue: Callus, score: 68.64	N	N	N	N
vg0920193283	T -> TCTATCC	LOC_Os09g34214.1	upstream_gene_variant ; 3424.0bp to feature; MODIFIER	silent_mutation	Average:35.391; most accessible tissue: Callus, score: 68.64	N	N	N	N
vg0920193283	T -> TCTATCC	LOC_Os09g34200.1	downstream_gene_variant ; 1699.0bp to feature; MODIFIER	silent_mutation	Average:35.391; most accessible tissue: Callus, score: 68.64	N	N	N	N
vg0920193283	T -> TCTATCC	LOC_Os09g34200-LOC_Os09g34214	intergenic_region ; MODIFIER	silent_mutation	Average:35.391; most accessible tissue: Callus, score: 68.64	N	N	N	N
vg0920193283	T -> C	LOC_Os09g34214.1	upstream_gene_variant ; 3425.0bp to feature; MODIFIER	silent_mutation	Average:35.391; most accessible tissue: Callus, score: 68.64	N	N	N	N
vg0920193283	T -> C	LOC_Os09g34200.1	downstream_gene_variant ; 1698.0bp to feature; MODIFIER	silent_mutation	Average:35.391; most accessible tissue: Callus, score: 68.64	N	N	N	N
vg0920193283	T -> C	LOC_Os09g34200-LOC_Os09g34214	intergenic_region ; MODIFIER	silent_mutation	Average:35.391; most accessible tissue: Callus, score: 68.64	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0920193283	NA	9.15E-17	mr1032	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	6.88E-18	mr1165	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	8.66E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	2.73E-08	mr1216	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	1.79E-12	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	5.27E-17	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	3.11E-20	mr1518	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	5.48E-06	1.94E-08	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	9.42E-21	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	4.87E-08	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	4.77E-07	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	2.08E-07	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	3.85E-07	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	3.65E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	2.67E-17	mr1040_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	3.42E-24	mr1233_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	1.40E-09	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	5.66E-22	mr1316_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	4.41E-08	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	7.57E-11	mr1349_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	1.33E-19	mr1362_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	7.56E-10	mr1398_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	4.78E-07	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	8.44E-19	mr1581_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	2.64E-08	8.69E-25	mr1676_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	7.37E-10	1.84E-14	mr1676_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	2.74E-09	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	1.24E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	1.88E-10	mr1756_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	9.45E-13	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	6.72E-16	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283	NA	6.13E-23	mr1949_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251