\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920193283:

Variant ID: vg0920193283 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 20193283
Reference Allele: TAlternative Allele: C,TCTATCC
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGTATTATAAATATTACTCCATCCATCTAATTTTGATTGGCATATTTCCAAATCTGAAAAATTACTTTTGATAGATATATTTCAATCCAACCACCTATC[T/C,TCTATCC]
TTTTAATGACTTTCTCAGATTGGTAACATGGACATCGAGAAATGTAAACATTAATGAATGACTTAGGTACGAGGAATAACTATTAGCCTGTTTAAATGGA

Reverse complement sequence

TCCATTTAAACAGGCTAATAGTTATTCCTCGTACCTAAGTCATTCATTAATGTTTACATTTCTCGATGTCCATGTTACCAATCTGAGAAAGTCATTAAAA[A/G,GGATAGA]
GATAGGTGGTTGGATTGAAATATATCTATCAAAAGTAATTTTTCAGATTTGGAAATATGCCAATCAAAATTAGATGGATGGAGTAATATTTATAATACTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.50% 28.80% 17.54% 17.18% TCTATCC: 0.91%
All Indica  2759 3.60% 48.60% 29.03% 17.47% TCTATCC: 1.34%
All Japonica  1512 97.90% 0.30% 0.20% 1.59% NA
Aus  269 0.70% 0.40% 3.72% 95.17% NA
Indica I  595 4.90% 40.20% 41.34% 13.61% NA
Indica II  465 5.80% 42.40% 34.19% 17.20% TCTATCC: 0.43%
Indica III  913 0.70% 58.50% 18.51% 20.15% TCTATCC: 2.19%
Indica Intermediate  786 4.60% 47.20% 28.88% 17.43% TCTATCC: 1.91%
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 97.60% 0.20% 0.00% 2.18% NA
Japonica Intermediate  241 92.90% 0.80% 0.83% 5.39% NA
VI/Aromatic  96 50.00% 1.00% 5.21% 41.67% TCTATCC: 2.08%
Intermediate  90 55.60% 17.80% 11.11% 11.11% TCTATCC: 4.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920193283 T -> DEL N N silent_mutation Average:35.391; most accessible tissue: Callus, score: 68.64 N N N N
vg0920193283 T -> TCTATCC LOC_Os09g34214.1 upstream_gene_variant ; 3424.0bp to feature; MODIFIER silent_mutation Average:35.391; most accessible tissue: Callus, score: 68.64 N N N N
vg0920193283 T -> TCTATCC LOC_Os09g34200.1 downstream_gene_variant ; 1699.0bp to feature; MODIFIER silent_mutation Average:35.391; most accessible tissue: Callus, score: 68.64 N N N N
vg0920193283 T -> TCTATCC LOC_Os09g34200-LOC_Os09g34214 intergenic_region ; MODIFIER silent_mutation Average:35.391; most accessible tissue: Callus, score: 68.64 N N N N
vg0920193283 T -> C LOC_Os09g34214.1 upstream_gene_variant ; 3425.0bp to feature; MODIFIER silent_mutation Average:35.391; most accessible tissue: Callus, score: 68.64 N N N N
vg0920193283 T -> C LOC_Os09g34200.1 downstream_gene_variant ; 1698.0bp to feature; MODIFIER silent_mutation Average:35.391; most accessible tissue: Callus, score: 68.64 N N N N
vg0920193283 T -> C LOC_Os09g34200-LOC_Os09g34214 intergenic_region ; MODIFIER silent_mutation Average:35.391; most accessible tissue: Callus, score: 68.64 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920193283 NA 9.15E-17 mr1032 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 6.88E-18 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 8.66E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 2.73E-08 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 1.79E-12 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 5.27E-17 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 3.11E-20 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 5.48E-06 1.94E-08 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 9.42E-21 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 4.87E-08 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 4.77E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 2.08E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 3.85E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 3.65E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 2.67E-17 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 3.42E-24 mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 1.40E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 5.66E-22 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 4.41E-08 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 7.57E-11 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 1.33E-19 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 7.56E-10 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 4.78E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 8.44E-19 mr1581_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 2.64E-08 8.69E-25 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 7.37E-10 1.84E-14 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 2.74E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 1.24E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 1.88E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 9.45E-13 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 6.72E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920193283 NA 6.13E-23 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251