\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920176425:

Variant ID: vg0920176425 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20176425
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.26, others allele: 0.00, population size: 38. )

Flanking Sequence (100 bp) in Reference Genome:


GTATGCCAAGGGAGAAACGGGCTTCTTCGTCATCTCGGGCTGGTTTGTTTTGTGGACTAAATTGGCCTTACCAATTTTTATTAATTTTAAATTTTGGTAA[T/C]
TTTTAGCATGGCTAGTAAAGGTAAAATTATGTTTGTATTGAAGCTAAAATAGTCTAAATTAACTGTTGAAATGGCCTATTTTTTTAGGTATGCCAAAATT

Reverse complement sequence

AATTTTGGCATACCTAAAAAAATAGGCCATTTCAACAGTTAATTTAGACTATTTTAGCTTCAATACAAACATAATTTTACCTTTACTAGCCATGCTAAAA[A/G]
TTACCAAAATTTAAAATTAATAAAAATTGGTAAGGCCAATTTAGTCCACAAAACAAACCAGCCCGAGATGACGAAGAAGCCCGTTTCTCCCTTGGCATAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.20% 38.40% 0.42% 9.92% NA
All Indica  2759 86.20% 8.00% 0.33% 5.47% NA
All Japonica  1512 0.50% 97.80% 0.20% 1.59% NA
Aus  269 1.90% 3.70% 1.12% 93.31% NA
Indica I  595 86.60% 5.00% 1.01% 7.39% NA
Indica II  465 90.50% 8.40% 0.00% 1.08% NA
Indica III  913 87.60% 6.90% 0.11% 5.37% NA
Indica Intermediate  786 81.80% 11.20% 0.25% 6.74% NA
Temperate Japonica  767 0.30% 99.60% 0.13% 0.00% NA
Tropical Japonica  504 0.20% 97.40% 0.20% 2.18% NA
Japonica Intermediate  241 1.70% 92.50% 0.41% 5.39% NA
VI/Aromatic  96 2.10% 57.30% 2.08% 38.54% NA
Intermediate  90 30.00% 60.00% 3.33% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920176425 T -> DEL N N silent_mutation Average:98.485; most accessible tissue: Callus, score: 99.765 N N N N
vg0920176425 T -> C LOC_Os09g34170.1 upstream_gene_variant ; 3792.0bp to feature; MODIFIER silent_mutation Average:98.485; most accessible tissue: Callus, score: 99.765 N N N N
vg0920176425 T -> C LOC_Os09g34180.1 upstream_gene_variant ; 3289.0bp to feature; MODIFIER silent_mutation Average:98.485; most accessible tissue: Callus, score: 99.765 N N N N
vg0920176425 T -> C LOC_Os09g34170-LOC_Os09g34180 intergenic_region ; MODIFIER silent_mutation Average:98.485; most accessible tissue: Callus, score: 99.765 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0920176425 T C -0.01 -0.03 -0.03 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920176425 9.44E-07 NA Grain_weight Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0920176425 NA 7.91E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920176425 NA 7.26E-10 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920176425 NA 1.26E-11 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920176425 NA 3.88E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920176425 2.57E-08 8.36E-09 mr1216 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920176425 4.35E-08 2.18E-12 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920176425 NA 6.67E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920176425 NA 1.56E-61 mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920176425 NA 1.30E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920176425 NA 6.46E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920176425 NA 1.84E-15 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920176425 NA 6.68E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920176425 NA 7.16E-08 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920176425 NA 7.41E-08 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920176425 NA 1.61E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920176425 NA 1.93E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920176425 NA 1.22E-06 mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920176425 NA 1.67E-12 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920176425 NA 1.02E-07 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920176425 NA 6.66E-34 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920176425 NA 8.59E-10 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920176425 NA 1.40E-06 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920176425 NA 3.85E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920176425 NA 1.71E-47 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251