\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920174968:

Variant ID: vg0920174968 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20174968
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTGTTCACAATCACAAATATTTATCGGTCTAGAAAGGAGGTAGATAAACACTTTTGATTTAACATTTCATAAGAAATGTCAAAACAAATAGATTTGAAT[T/C]
TAAATATTACTAGTAAAGTACTTTAGATTATAAATATAATTAATACAACCTTGATACTAAACACTAATGGTTAAAGTAGTCAGACTACTTTAAAAAACAT

Reverse complement sequence

ATGTTTTTTAAAGTAGTCTGACTACTTTAACCATTAGTGTTTAGTATCAAGGTTGTATTAATTATATTTATAATCTAAAGTACTTTACTAGTAATATTTA[A/G]
ATTCAAATCTATTTGTTTTGACATTTCTTATGAAATGTTAAATCAAAAGTGTTTATCTACCTCCTTTCTAGACCGATAAATATTTGTGATTGTGAACAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.50% 0.30% 1.29% 65.91% NA
All Indica  2759 3.50% 0.20% 1.38% 94.89% NA
All Japonica  1512 89.00% 0.10% 0.53% 10.32% NA
Aus  269 0.40% 2.20% 4.46% 92.94% NA
Indica I  595 4.40% 0.00% 2.52% 93.11% NA
Indica II  465 5.40% 0.20% 0.22% 94.19% NA
Indica III  913 0.80% 0.30% 0.55% 98.36% NA
Indica Intermediate  786 5.00% 0.30% 2.16% 92.62% NA
Temperate Japonica  767 89.20% 0.30% 0.78% 9.78% NA
Tropical Japonica  504 96.80% 0.00% 0.00% 3.17% NA
Japonica Intermediate  241 72.20% 0.00% 0.83% 26.97% NA
VI/Aromatic  96 41.70% 0.00% 1.04% 57.29% NA
Intermediate  90 55.60% 2.20% 2.22% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920174968 T -> DEL N N silent_mutation Average:47.297; most accessible tissue: Callus, score: 85.213 N N N N
vg0920174968 T -> C LOC_Os09g34170.1 upstream_gene_variant ; 2335.0bp to feature; MODIFIER silent_mutation Average:47.297; most accessible tissue: Callus, score: 85.213 N N N N
vg0920174968 T -> C LOC_Os09g34180.1 upstream_gene_variant ; 4746.0bp to feature; MODIFIER silent_mutation Average:47.297; most accessible tissue: Callus, score: 85.213 N N N N
vg0920174968 T -> C LOC_Os09g34170-LOC_Os09g34180 intergenic_region ; MODIFIER silent_mutation Average:47.297; most accessible tissue: Callus, score: 85.213 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920174968 NA 2.83E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 6.82E-12 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 1.94E-10 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 4.89E-08 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 6.73E-06 5.42E-09 mr1216 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 7.72E-06 1.30E-11 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 3.81E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 8.28E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 2.48E-14 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 2.80E-07 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 7.34E-08 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 7.43E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 2.08E-09 mr1796 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 6.47E-09 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 1.86E-11 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 5.14E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 9.73E-09 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 3.83E-14 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 5.05E-07 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 4.04E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 7.79E-09 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 5.52E-07 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 5.56E-07 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 1.35E-16 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 8.93E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 4.69E-11 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 4.98E-46 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 5.68E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968 NA 1.25E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251