Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920174968:

Variant ID: vg0920174968 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 20174968
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTGTTCACAATCACAAATATTTATCGGTCTAGAAAGGAGGTAGATAAACACTTTTGATTTAACATTTCATAAGAAATGTCAAAACAAATAGATTTGAAT[T/C]
TAAATATTACTAGTAAAGTACTTTAGATTATAAATATAATTAATACAACCTTGATACTAAACACTAATGGTTAAAGTAGTCAGACTACTTTAAAAAACAT

Reverse complement sequence

ATGTTTTTTAAAGTAGTCTGACTACTTTAACCATTAGTGTTTAGTATCAAGGTTGTATTAATTATATTTATAATCTAAAGTACTTTACTAGTAATATTTA[A/G]
ATTCAAATCTATTTGTTTTGACATTTCTTATGAAATGTTAAATCAAAAGTGTTTATCTACCTCCTTTCTAGACCGATAAATATTTGTGATTGTGAACAGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.50%	0.30%	1.29%	65.91%	NA
All Indica	2759	3.50%	0.20%	1.38%	94.89%	NA
All Japonica	1512	89.00%	0.10%	0.53%	10.32%	NA
Aus	269	0.40%	2.20%	4.46%	92.94%	NA
Indica I	595	4.40%	0.00%	2.52%	93.11%	NA
Indica II	465	5.40%	0.20%	0.22%	94.19%	NA
Indica III	913	0.80%	0.30%	0.55%	98.36%	NA
Indica Intermediate	786	5.00%	0.30%	2.16%	92.62%	NA
Temperate Japonica	767	89.20%	0.30%	0.78%	9.78%	NA
Tropical Japonica	504	96.80%	0.00%	0.00%	3.17%	NA
Japonica Intermediate	241	72.20%	0.00%	0.83%	26.97%	NA
VI/Aromatic	96	41.70%	0.00%	1.04%	57.29%	NA
Intermediate	90	55.60%	2.20%	2.22%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0920174968	T -> DEL	N	N	silent_mutation	Average:47.297; most accessible tissue: Callus, score: 85.213	N	N	N	N
vg0920174968	T -> C	LOC_Os09g34170.1	upstream_gene_variant ; 2335.0bp to feature; MODIFIER	silent_mutation	Average:47.297; most accessible tissue: Callus, score: 85.213	N	N	N	N
vg0920174968	T -> C	LOC_Os09g34180.1	upstream_gene_variant ; 4746.0bp to feature; MODIFIER	silent_mutation	Average:47.297; most accessible tissue: Callus, score: 85.213	N	N	N	N
vg0920174968	T -> C	LOC_Os09g34170-LOC_Os09g34180	intergenic_region ; MODIFIER	silent_mutation	Average:47.297; most accessible tissue: Callus, score: 85.213	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0920174968	NA	2.83E-07	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	6.82E-12	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	1.94E-10	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	4.89E-08	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	6.73E-06	5.42E-09	mr1216	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	7.72E-06	1.30E-11	mr1216	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	3.81E-06	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	8.28E-08	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	2.48E-14	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	2.80E-07	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	7.34E-08	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	7.43E-06	mr1782	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	2.08E-09	mr1796	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	6.47E-09	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	1.86E-11	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	5.14E-12	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	9.73E-09	mr1172_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	3.83E-14	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	5.05E-07	mr1246_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	4.04E-06	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	7.79E-09	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	5.52E-07	mr1676_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	5.56E-07	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	1.35E-16	mr1744_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	8.93E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	4.69E-11	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	4.98E-46	mr1793_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	5.68E-07	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920174968	NA	1.25E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251