\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920166366:

Variant ID: vg0920166366 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20166366
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


ATCAACGGCGTCAAACATTTAGGGACGGAGGGAGTATATAATTTTTCCCGCAAAAAGTATATAATTTTACTAAAAAGATTTATAAGACTATTCTACACAT[G/A]
TGATCTCTATATTTCAAAGACAAATATTGTAAGAGATTATTCATAGTAGAAGATTTTTAAGTTTTTTTGACGGAAAGATGATTTTTTAAAGTTTGATCTC

Reverse complement sequence

GAGATCAAACTTTAAAAAATCATCTTTCCGTCAAAAAAACTTAAAAATCTTCTACTATGAATAATCTCTTACAATATTTGTCTTTGAAATATAGAGATCA[C/T]
ATGTGTAGAATAGTCTTATAAATCTTTTTAGTAAAATTATATACTTTTTGCGGGAAAAATTATATACTCCCTCCGTCCCTAAATGTTTGACGCCGTTGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.50% 35.50% 2.41% 10.66% NA
All Indica  2759 86.60% 3.40% 1.59% 8.45% NA
All Japonica  1512 0.40% 98.00% 0.26% 1.32% NA
Aus  269 4.10% 0.40% 16.73% 78.81% NA
Indica I  595 87.40% 4.20% 2.02% 6.39% NA
Indica II  465 90.30% 5.80% 0.22% 3.66% NA
Indica III  913 88.00% 0.30% 1.75% 9.97% NA
Indica Intermediate  786 82.20% 4.80% 1.91% 11.07% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 97.40% 0.20% 1.79% NA
Japonica Intermediate  241 0.80% 93.40% 1.24% 4.56% NA
VI/Aromatic  96 4.20% 50.00% 17.71% 28.12% NA
Intermediate  90 24.40% 57.80% 4.44% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920166366 G -> DEL N N silent_mutation Average:53.528; most accessible tissue: Zhenshan97 root, score: 77.09 N N N N
vg0920166366 G -> A LOC_Os09g34150.1 upstream_gene_variant ; 4358.0bp to feature; MODIFIER silent_mutation Average:53.528; most accessible tissue: Zhenshan97 root, score: 77.09 N N N N
vg0920166366 G -> A LOC_Os09g34150.2 upstream_gene_variant ; 4358.0bp to feature; MODIFIER silent_mutation Average:53.528; most accessible tissue: Zhenshan97 root, score: 77.09 N N N N
vg0920166366 G -> A LOC_Os09g34160.1 intron_variant ; MODIFIER silent_mutation Average:53.528; most accessible tissue: Zhenshan97 root, score: 77.09 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920166366 NA 1.20E-105 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 4.86E-103 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 5.36E-69 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 8.43E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 2.41E-17 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 1.41E-10 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 7.99E-06 1.50E-09 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 7.53E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 1.07E-15 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 1.04E-16 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 1.98E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 7.00E-14 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 3.93E-33 mr1333 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 2.54E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 1.43E-07 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 1.83E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 3.34E-10 5.58E-26 mr1518 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 7.75E-10 3.35E-13 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 5.11E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 6.32E-11 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 5.28E-11 1.99E-28 mr1676 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 9.13E-12 1.68E-16 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 5.41E-28 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 8.84E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 7.32E-19 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 2.85E-20 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 3.06E-06 mr1064_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 2.74E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 7.91E-17 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 3.18E-44 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 4.06E-19 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 9.99E-14 4.70E-32 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 1.34E-17 1.47E-21 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920166366 NA 3.69E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251