\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920162336:

Variant ID: vg0920162336 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20162336
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACTTGGTAGTAAGCTTATGACTTGATAGTAGCTGTTTATTACTTTTATAATGTATCTTACCTGTAGTAAGAATATTTTAATTCCTATTACCTACTTTTT[T/C]
ATAGATGTCCTTAATTGGTCAAATGGTAAGCTCTGAGTCTCTGGCATTGACTTACAAGTCATCGAGTCAACGGCTAGTCCACGCCACGCCAGGCCCCACG

Reverse complement sequence

CGTGGGGCCTGGCGTGGCGTGGACTAGCCGTTGACTCGATGACTTGTAAGTCAATGCCAGAGACTCAGAGCTTACCATTTGACCAATTAAGGACATCTAT[A/G]
AAAAAGTAGGTAATAGGAATTAAAATATTCTTACTACAGGTAAGATACATTATAAAAGTAATAAACAGCTACTATCAAGTCATAAGCTTACTACCAAGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.60% 4.10% 5.88% 57.38% NA
All Indica  2759 3.60% 1.70% 4.60% 90.07% NA
All Japonica  1512 89.00% 9.10% 0.53% 1.39% NA
Aus  269 0.70% 0.00% 41.64% 57.62% NA
Indica I  595 4.50% 3.00% 2.86% 89.58% NA
Indica II  465 5.60% 1.10% 2.15% 91.18% NA
Indica III  913 0.80% 1.40% 4.49% 93.32% NA
Indica Intermediate  786 5.00% 1.50% 7.51% 86.01% NA
Temperate Japonica  767 89.00% 10.80% 0.00% 0.13% NA
Tropical Japonica  504 96.60% 1.20% 0.20% 1.98% NA
Japonica Intermediate  241 72.60% 20.30% 2.90% 4.15% NA
VI/Aromatic  96 41.70% 9.40% 23.96% 25.00% NA
Intermediate  90 60.00% 1.10% 8.89% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920162336 T -> DEL N N silent_mutation Average:95.237; most accessible tissue: Zhenshan97 young leaf, score: 98.681 N N N N
vg0920162336 T -> C LOC_Os09g34150.1 upstream_gene_variant ; 328.0bp to feature; MODIFIER silent_mutation Average:95.237; most accessible tissue: Zhenshan97 young leaf, score: 98.681 N N N N
vg0920162336 T -> C LOC_Os09g34150.2 upstream_gene_variant ; 328.0bp to feature; MODIFIER silent_mutation Average:95.237; most accessible tissue: Zhenshan97 young leaf, score: 98.681 N N N N
vg0920162336 T -> C LOC_Os09g34160.1 downstream_gene_variant ; 334.0bp to feature; MODIFIER silent_mutation Average:95.237; most accessible tissue: Zhenshan97 young leaf, score: 98.681 N N N N
vg0920162336 T -> C LOC_Os09g34140.2 downstream_gene_variant ; 4080.0bp to feature; MODIFIER silent_mutation Average:95.237; most accessible tissue: Zhenshan97 young leaf, score: 98.681 N N N N
vg0920162336 T -> C LOC_Os09g34150-LOC_Os09g34160 intergenic_region ; MODIFIER silent_mutation Average:95.237; most accessible tissue: Zhenshan97 young leaf, score: 98.681 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0920162336 T C -0.09 -0.09 -0.09 -0.07 -0.07 -0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920162336 NA 2.98E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 6.46E-11 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 4.70E-10 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 1.06E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 5.74E-09 mr1216 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 8.79E-07 3.50E-11 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 6.33E-08 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 3.75E-15 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 2.29E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 1.37E-07 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 1.06E-08 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 5.95E-06 mr1812 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 3.83E-08 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 2.04E-13 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 8.95E-07 mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 2.50E-15 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 1.89E-08 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 6.18E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 6.89E-07 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 2.22E-08 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 3.22E-06 mr1565_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 3.33E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 7.80E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 9.91E-07 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 1.94E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 1.03E-10 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 2.60E-15 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 6.31E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 1.45E-13 mr1782_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 5.65E-08 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162336 NA 2.46E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251