Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920157522:

Variant ID: vg0920157522 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 20157522
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTCGAGTACTTGCAAAATATATATTAAAAAAAAAAAGTGATACTCCATCCGTTTCGAAATGTTTGACGCCGTTGACTTTTTAGCACATGTTTGACCATT[C/T]
GTCTTATTCAAAAAATTTAAGTAATTATTGATTCTTTTCATATCATTTAATTCATTGTTAAATATATTTTTATGTAGGCATATAATTTTACATATTTCAC

Reverse complement sequence

GTGAAATATGTAAAATTATATGCCTACATAAAAATATATTTAACAATGAATTAAATGATATGAAAAGAATCAATAATTACTTAAATTTTTTGAATAAGAC[G/A]
AATGGTCAAACATGTGCTAAAAAGTCAACGGCGTCAAACATTTCGAAACGGATGGAGTATCACTTTTTTTTTTTAATATATATTTTGCAAGTACTCGAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.30%	3.10%	1.14%	3.43%	NA
All Indica	2759	97.00%	0.00%	0.58%	2.36%	NA
All Japonica	1512	90.40%	9.10%	0.13%	0.33%	NA
Aus	269	59.50%	0.00%	12.27%	28.25%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.10%	0.20%	0.00%	0.65%	NA
Indica III	913	96.30%	0.00%	0.88%	2.85%	NA
Indica Intermediate	786	94.40%	0.00%	1.02%	4.58%	NA
Temperate Japonica	767	88.90%	11.00%	0.13%	0.00%	NA
Tropical Japonica	504	98.60%	1.20%	0.00%	0.20%	NA
Japonica Intermediate	241	78.00%	19.90%	0.41%	1.66%	NA
VI/Aromatic	96	81.20%	8.30%	1.04%	9.38%	NA
Intermediate	90	88.90%	1.10%	2.22%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0920157522	C -> DEL	N	N	silent_mutation	Average:57.273; most accessible tissue: Zhenshan97 root, score: 78.63	N	N	N	N
vg0920157522	C -> T	LOC_Os09g34130.1	upstream_gene_variant ; 3262.0bp to feature; MODIFIER	silent_mutation	Average:57.273; most accessible tissue: Zhenshan97 root, score: 78.63	N	N	N	N
vg0920157522	C -> T	LOC_Os09g34140.1	downstream_gene_variant ; 198.0bp to feature; MODIFIER	silent_mutation	Average:57.273; most accessible tissue: Zhenshan97 root, score: 78.63	N	N	N	N
vg0920157522	C -> T	LOC_Os09g34150.1	downstream_gene_variant ; 184.0bp to feature; MODIFIER	silent_mutation	Average:57.273; most accessible tissue: Zhenshan97 root, score: 78.63	N	N	N	N
vg0920157522	C -> T	LOC_Os09g34150.2	downstream_gene_variant ; 178.0bp to feature; MODIFIER	silent_mutation	Average:57.273; most accessible tissue: Zhenshan97 root, score: 78.63	N	N	N	N
vg0920157522	C -> T	LOC_Os09g34140.2	intron_variant ; MODIFIER	silent_mutation	Average:57.273; most accessible tissue: Zhenshan97 root, score: 78.63	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0920157522	9.29E-06	NA	mr1789	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920157522	7.22E-07	NA	mr1879	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920157522	NA	5.46E-07	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920157522	NA	3.22E-06	mr1565_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251