\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920157522:

Variant ID: vg0920157522 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20157522
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTCGAGTACTTGCAAAATATATATTAAAAAAAAAAAGTGATACTCCATCCGTTTCGAAATGTTTGACGCCGTTGACTTTTTAGCACATGTTTGACCATT[C/T]
GTCTTATTCAAAAAATTTAAGTAATTATTGATTCTTTTCATATCATTTAATTCATTGTTAAATATATTTTTATGTAGGCATATAATTTTACATATTTCAC

Reverse complement sequence

GTGAAATATGTAAAATTATATGCCTACATAAAAATATATTTAACAATGAATTAAATGATATGAAAAGAATCAATAATTACTTAAATTTTTTGAATAAGAC[G/A]
AATGGTCAAACATGTGCTAAAAAGTCAACGGCGTCAAACATTTCGAAACGGATGGAGTATCACTTTTTTTTTTTAATATATATTTTGCAAGTACTCGAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.30% 3.10% 1.14% 3.43% NA
All Indica  2759 97.00% 0.00% 0.58% 2.36% NA
All Japonica  1512 90.40% 9.10% 0.13% 0.33% NA
Aus  269 59.50% 0.00% 12.27% 28.25% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.20% 0.00% 0.65% NA
Indica III  913 96.30% 0.00% 0.88% 2.85% NA
Indica Intermediate  786 94.40% 0.00% 1.02% 4.58% NA
Temperate Japonica  767 88.90% 11.00% 0.13% 0.00% NA
Tropical Japonica  504 98.60% 1.20% 0.00% 0.20% NA
Japonica Intermediate  241 78.00% 19.90% 0.41% 1.66% NA
VI/Aromatic  96 81.20% 8.30% 1.04% 9.38% NA
Intermediate  90 88.90% 1.10% 2.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920157522 C -> DEL N N silent_mutation Average:57.273; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg0920157522 C -> T LOC_Os09g34130.1 upstream_gene_variant ; 3262.0bp to feature; MODIFIER silent_mutation Average:57.273; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg0920157522 C -> T LOC_Os09g34140.1 downstream_gene_variant ; 198.0bp to feature; MODIFIER silent_mutation Average:57.273; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg0920157522 C -> T LOC_Os09g34150.1 downstream_gene_variant ; 184.0bp to feature; MODIFIER silent_mutation Average:57.273; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg0920157522 C -> T LOC_Os09g34150.2 downstream_gene_variant ; 178.0bp to feature; MODIFIER silent_mutation Average:57.273; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg0920157522 C -> T LOC_Os09g34140.2 intron_variant ; MODIFIER silent_mutation Average:57.273; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920157522 9.29E-06 NA mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920157522 7.22E-07 NA mr1879 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920157522 NA 5.46E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920157522 NA 3.22E-06 mr1565_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251