Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920091049:

Variant ID: vg0920091049 (JBrowse)	Variation Type: INDEL
Chromosome: chr09	Position: 20091049
Reference Allele: T	Alternative Allele: A,TA
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.87, T: 0.13, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

AAGGGTGGATGGAACACCTTCAATAGAGAATCCTTCTTCGCGTTGAATTTCAATTAGAAAAATAGATTCATAAAAGACCATCATCTACATATATTTTTTT[T/A,TA]
AAAAAAGAACTTTTGTAAAACTTGACGTGCCATCATACTTGTAGTAAGATGCAATAAAGAAAATGACTCTAGAGGGTTTGCTTGAGTAAGTATCTGGCAG

Reverse complement sequence

CTGCCAGATACTTACTCAAGCAAACCCTCTAGAGTCATTTTCTTTATTGCATCTTACTACAAGTATGATGGCACGTCAAGTTTTACAAAAGTTCTTTTTT[A/T,TA]
AAAAAAATATATGTAGATGATGGTCTTTTATGAATCTATTTTTCTAATTGAAATTCAACGCGAAGAAGGATTCTCTATTGAAGGTGTTCCATCCACCCTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.70%	36.00%	0.11%	0.00%	TA: 0.23%
All Indica	2759	94.00%	5.40%	0.18%	0.00%	TA: 0.36%
All Japonica	1512	10.40%	89.60%	0.00%	0.00%	TA: 0.07%
Aus	269	72.50%	27.50%	0.00%	0.00%	NA
Indica I	595	95.50%	3.90%	0.34%	0.00%	TA: 0.34%
Indica II	465	93.30%	5.60%	0.22%	0.00%	TA: 0.86%
Indica III	913	96.90%	2.70%	0.00%	0.00%	TA: 0.33%
Indica Intermediate	786	89.90%	9.70%	0.25%	0.00%	TA: 0.13%
Temperate Japonica	767	12.10%	87.70%	0.00%	0.00%	TA: 0.13%
Tropical Japonica	504	1.80%	98.20%	0.00%	0.00%	NA
Japonica Intermediate	241	22.80%	77.20%	0.00%	0.00%	NA
VI/Aromatic	96	29.20%	70.80%	0.00%	0.00%	NA
Intermediate	90	38.90%	61.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0920091049	T -> TA	LOC_Os09g34040.1	upstream_gene_variant ; 457.0bp to feature; MODIFIER	silent_mutation	Average:64.441; most accessible tissue: Callus, score: 87.5	N	N	N	N
vg0920091049	T -> TA	LOC_Os09g34050.1	upstream_gene_variant ; 313.0bp to feature; MODIFIER	silent_mutation	Average:64.441; most accessible tissue: Callus, score: 87.5	N	N	N	N
vg0920091049	T -> TA	LOC_Os09g34060.1	downstream_gene_variant ; 3072.0bp to feature; MODIFIER	silent_mutation	Average:64.441; most accessible tissue: Callus, score: 87.5	N	N	N	N
vg0920091049	T -> TA	LOC_Os09g34040-LOC_Os09g34050	intergenic_region ; MODIFIER	silent_mutation	Average:64.441; most accessible tissue: Callus, score: 87.5	N	N	N	N
vg0920091049	T -> A	LOC_Os09g34040.1	upstream_gene_variant ; 456.0bp to feature; MODIFIER	silent_mutation	Average:64.441; most accessible tissue: Callus, score: 87.5	N	N	N	N
vg0920091049	T -> A	LOC_Os09g34050.1	upstream_gene_variant ; 314.0bp to feature; MODIFIER	silent_mutation	Average:64.441; most accessible tissue: Callus, score: 87.5	N	N	N	N
vg0920091049	T -> A	LOC_Os09g34060.1	downstream_gene_variant ; 3073.0bp to feature; MODIFIER	silent_mutation	Average:64.441; most accessible tissue: Callus, score: 87.5	N	N	N	N
vg0920091049	T -> A	LOC_Os09g34040-LOC_Os09g34050	intergenic_region ; MODIFIER	silent_mutation	Average:64.441; most accessible tissue: Callus, score: 87.5	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0920091049	NA	6.25E-09	mr1050	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	NA	4.90E-08	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	NA	5.57E-11	mr1272	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	NA	9.47E-18	mr1324	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	NA	6.48E-12	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	NA	1.49E-13	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	NA	5.39E-15	mr1335	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	NA	4.60E-20	mr1518	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	NA	2.87E-07	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	NA	6.33E-07	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	NA	8.97E-08	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	NA	9.48E-24	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	NA	1.83E-07	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	NA	1.20E-06	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	NA	2.12E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	9.10E-07	NA	mr1879	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	NA	7.48E-15	mr1950	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	NA	6.74E-09	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	NA	7.72E-06	mr1064_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	2.82E-06	NA	mr1071_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	7.77E-06	NA	mr1080_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	1.62E-06	8.84E-08	mr1100_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	2.96E-08	3.15E-09	mr1203_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	NA	6.64E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	8.42E-07	9.28E-26	mr1676_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920091049	2.73E-11	2.64E-14	mr1676_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251