Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0920086430:

Variant ID: vg0920086430 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 20086430
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

TAGCGATATAAAAACAAAGGCTGAAAAATAAACTTTGATGAAAAAACCCCCAAAATCAACTCTAAATTTAAGGTTGAAACTTCAAATTTTAGCTGATAAG[C/T]
ATAAGCATAAGCGAAAAGATGAGGCCGTATGAAATTCTATCTTTCTACTCAATTGTGAATTGCGATGAGAACAAAAATTAATTACTCCTGTAAGTCGAAT

Reverse complement sequence

ATTCGACTTACAGGAGTAATTAATTTTTGTTCTCATCGCAATTCACAATTGAGTAGAAAGATAGAATTTCATACGGCCTCATCTTTTCGCTTATGCTTAT[G/A]
CTTATCAGCTAAAATTTGAAGTTTCAACCTTAAATTTAGAGTTGATTTTGGGGGTTTTTTCATCAAAGTTTATTTTTCAGCCTTTGTTTTTATATCGCTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.60%	49.40%	0.04%	0.00%	NA
All Indica	2759	84.80%	15.20%	0.00%	0.00%	NA
All Japonica	1512	0.10%	99.90%	0.00%	0.00%	NA
Aus	269	10.80%	89.20%	0.00%	0.00%	NA
Indica I	595	88.90%	11.10%	0.00%	0.00%	NA
Indica II	465	85.60%	14.40%	0.00%	0.00%	NA
Indica III	913	88.10%	11.90%	0.00%	0.00%	NA
Indica Intermediate	786	77.40%	22.60%	0.00%	0.00%	NA
Temperate Japonica	767	0.10%	99.90%	0.00%	0.00%	NA
Tropical Japonica	504	0.00%	100.00%	0.00%	0.00%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	97.90%	1.04%	0.00%	NA
Intermediate	90	21.10%	77.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0920086430	C -> T	LOC_Os09g34020.1	upstream_gene_variant ; 2986.0bp to feature; MODIFIER	silent_mutation	Average:49.189; most accessible tissue: Callus, score: 83.416	N	N	N	N
vg0920086430	C -> T	LOC_Os09g34050.1	upstream_gene_variant ; 4933.0bp to feature; MODIFIER	silent_mutation	Average:49.189; most accessible tissue: Callus, score: 83.416	N	N	N	N
vg0920086430	C -> T	LOC_Os09g34010.1	downstream_gene_variant ; 3793.0bp to feature; MODIFIER	silent_mutation	Average:49.189; most accessible tissue: Callus, score: 83.416	N	N	N	N
vg0920086430	C -> T	LOC_Os09g34030.1	downstream_gene_variant ; 1535.0bp to feature; MODIFIER	silent_mutation	Average:49.189; most accessible tissue: Callus, score: 83.416	N	N	N	N
vg0920086430	C -> T	LOC_Os09g34040.1	downstream_gene_variant ; 181.0bp to feature; MODIFIER	silent_mutation	Average:49.189; most accessible tissue: Callus, score: 83.416	N	N	N	N
vg0920086430	C -> T	LOC_Os09g34030-LOC_Os09g34040	intergenic_region ; MODIFIER	silent_mutation	Average:49.189; most accessible tissue: Callus, score: 83.416	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0920086430	NA	1.96E-10	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430	NA	4.66E-15	mr1165	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430	NA	3.52E-11	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430	2.04E-22	9.67E-18	mr1216	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430	6.04E-18	5.31E-28	mr1216	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430	NA	1.15E-12	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430	NA	1.24E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430	NA	1.15E-12	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430	NA	2.33E-32	mr1793	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430	NA	3.91E-07	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430	NA	1.30E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430	NA	4.21E-06	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430	1.49E-07	3.22E-53	mr1793_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430	5.83E-06	7.66E-08	mr1793_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251