\
| Variant ID: vg0920086430 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 20086430 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 195. )
TAGCGATATAAAAACAAAGGCTGAAAAATAAACTTTGATGAAAAAACCCCCAAAATCAACTCTAAATTTAAGGTTGAAACTTCAAATTTTAGCTGATAAG[C/T]
ATAAGCATAAGCGAAAAGATGAGGCCGTATGAAATTCTATCTTTCTACTCAATTGTGAATTGCGATGAGAACAAAAATTAATTACTCCTGTAAGTCGAAT
ATTCGACTTACAGGAGTAATTAATTTTTGTTCTCATCGCAATTCACAATTGAGTAGAAAGATAGAATTTCATACGGCCTCATCTTTTCGCTTATGCTTAT[G/A]
CTTATCAGCTAAAATTTGAAGTTTCAACCTTAAATTTAGAGTTGATTTTGGGGGTTTTTTCATCAAAGTTTATTTTTCAGCCTTTGTTTTTATATCGCTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.60% | 49.40% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 84.80% | 15.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 0.10% | 99.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 10.80% | 89.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 88.10% | 11.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 77.40% | 22.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.10% | 99.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 97.90% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 21.10% | 77.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0920086430 | C -> T | LOC_Os09g34020.1 | upstream_gene_variant ; 2986.0bp to feature; MODIFIER | silent_mutation | Average:49.189; most accessible tissue: Callus, score: 83.416 | N | N | N | N |
| vg0920086430 | C -> T | LOC_Os09g34050.1 | upstream_gene_variant ; 4933.0bp to feature; MODIFIER | silent_mutation | Average:49.189; most accessible tissue: Callus, score: 83.416 | N | N | N | N |
| vg0920086430 | C -> T | LOC_Os09g34010.1 | downstream_gene_variant ; 3793.0bp to feature; MODIFIER | silent_mutation | Average:49.189; most accessible tissue: Callus, score: 83.416 | N | N | N | N |
| vg0920086430 | C -> T | LOC_Os09g34030.1 | downstream_gene_variant ; 1535.0bp to feature; MODIFIER | silent_mutation | Average:49.189; most accessible tissue: Callus, score: 83.416 | N | N | N | N |
| vg0920086430 | C -> T | LOC_Os09g34040.1 | downstream_gene_variant ; 181.0bp to feature; MODIFIER | silent_mutation | Average:49.189; most accessible tissue: Callus, score: 83.416 | N | N | N | N |
| vg0920086430 | C -> T | LOC_Os09g34030-LOC_Os09g34040 | intergenic_region ; MODIFIER | silent_mutation | Average:49.189; most accessible tissue: Callus, score: 83.416 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0920086430 | NA | 1.96E-10 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920086430 | NA | 4.66E-15 | mr1165 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920086430 | NA | 3.52E-11 | mr1172 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920086430 | 2.04E-22 | 9.67E-18 | mr1216 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920086430 | 6.04E-18 | 5.31E-28 | mr1216 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920086430 | NA | 1.15E-12 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920086430 | NA | 1.24E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920086430 | NA | 1.15E-12 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920086430 | NA | 2.33E-32 | mr1793 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920086430 | NA | 3.91E-07 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920086430 | NA | 1.30E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920086430 | NA | 4.21E-06 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920086430 | 1.49E-07 | 3.22E-53 | mr1793_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920086430 | 5.83E-06 | 7.66E-08 | mr1793_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |