\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920086430:

Variant ID: vg0920086430 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20086430
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


TAGCGATATAAAAACAAAGGCTGAAAAATAAACTTTGATGAAAAAACCCCCAAAATCAACTCTAAATTTAAGGTTGAAACTTCAAATTTTAGCTGATAAG[C/T]
ATAAGCATAAGCGAAAAGATGAGGCCGTATGAAATTCTATCTTTCTACTCAATTGTGAATTGCGATGAGAACAAAAATTAATTACTCCTGTAAGTCGAAT

Reverse complement sequence

ATTCGACTTACAGGAGTAATTAATTTTTGTTCTCATCGCAATTCACAATTGAGTAGAAAGATAGAATTTCATACGGCCTCATCTTTTCGCTTATGCTTAT[G/A]
CTTATCAGCTAAAATTTGAAGTTTCAACCTTAAATTTAGAGTTGATTTTGGGGGTTTTTTCATCAAAGTTTATTTTTCAGCCTTTGTTTTTATATCGCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.60% 49.40% 0.04% 0.00% NA
All Indica  2759 84.80% 15.20% 0.00% 0.00% NA
All Japonica  1512 0.10% 99.90% 0.00% 0.00% NA
Aus  269 10.80% 89.20% 0.00% 0.00% NA
Indica I  595 88.90% 11.10% 0.00% 0.00% NA
Indica II  465 85.60% 14.40% 0.00% 0.00% NA
Indica III  913 88.10% 11.90% 0.00% 0.00% NA
Indica Intermediate  786 77.40% 22.60% 0.00% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.00% 100.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 97.90% 1.04% 0.00% NA
Intermediate  90 21.10% 77.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920086430 C -> T LOC_Os09g34020.1 upstream_gene_variant ; 2986.0bp to feature; MODIFIER silent_mutation Average:49.189; most accessible tissue: Callus, score: 83.416 N N N N
vg0920086430 C -> T LOC_Os09g34050.1 upstream_gene_variant ; 4933.0bp to feature; MODIFIER silent_mutation Average:49.189; most accessible tissue: Callus, score: 83.416 N N N N
vg0920086430 C -> T LOC_Os09g34010.1 downstream_gene_variant ; 3793.0bp to feature; MODIFIER silent_mutation Average:49.189; most accessible tissue: Callus, score: 83.416 N N N N
vg0920086430 C -> T LOC_Os09g34030.1 downstream_gene_variant ; 1535.0bp to feature; MODIFIER silent_mutation Average:49.189; most accessible tissue: Callus, score: 83.416 N N N N
vg0920086430 C -> T LOC_Os09g34040.1 downstream_gene_variant ; 181.0bp to feature; MODIFIER silent_mutation Average:49.189; most accessible tissue: Callus, score: 83.416 N N N N
vg0920086430 C -> T LOC_Os09g34030-LOC_Os09g34040 intergenic_region ; MODIFIER silent_mutation Average:49.189; most accessible tissue: Callus, score: 83.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920086430 NA 1.96E-10 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430 NA 4.66E-15 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430 NA 3.52E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430 2.04E-22 9.67E-18 mr1216 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430 6.04E-18 5.31E-28 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430 NA 1.15E-12 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430 NA 1.24E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430 NA 1.15E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430 NA 2.33E-32 mr1793 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430 NA 3.91E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430 NA 1.30E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430 NA 4.21E-06 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430 1.49E-07 3.22E-53 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920086430 5.83E-06 7.66E-08 mr1793_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251