Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920049900:

Variant ID: vg0920049900 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20049900
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


ACGTCAGCTTCTTTTGTAGTCATCCATGCAAGGTCTTTTTCAACTAGTCTAGTGTGAGCTCTCACTGTACTAGTAAGTGCATGGCTGACTTGTTTTACTG[A/G]
TCTTTACTTTGTAGTAAAGGGGAAGAAAGAAGGAAAGCTGGTAAATATATTATTCTGGTCTAACTGTGGTCAAGTCTACATGTCCAAATCTTAGATCTGC

Reverse complement sequence

GCAGATCTAAGATTTGGACATGTAGACTTGACCACAGTTAGACCAGAATAATATATTTACCAGCTTTCCTTCTTTCTTCCCCTTTACTACAAAGTAAAGA[T/C]
CAGTAAAACAAGTCAGCCATGCACTTACTAGTACAGTGAGAGCTCACACTAGACTAGTTGAAAAAGACCTTGCATGGATGACTACAAAAGAAGCTGACGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.70% 28.80% 0.44% 0.00% NA
All Indica  2759 97.20% 2.70% 0.11% 0.00% NA
All Japonica  1512 19.40% 79.60% 1.06% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 97.00% 2.70% 0.34% 0.00% NA
Indica II  465 94.80% 4.90% 0.22% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 95.90% 4.10% 0.00% 0.00% NA
Temperate Japonica  767 21.90% 76.30% 1.83% 0.00% NA
Tropical Japonica  504 11.10% 88.70% 0.20% 0.00% NA
Japonica Intermediate  241 28.60% 71.00% 0.41% 0.00% NA
VI/Aromatic  96 58.30% 41.70% 0.00% 0.00% NA
Intermediate  90 48.90% 48.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920049900 A -> G LOC_Os09g33970.1 upstream_gene_variant ; 3875.0bp to feature; MODIFIER silent_mutation Average:53.968; most accessible tissue: Callus, score: 73.122 N N N N
vg0920049900 A -> G LOC_Os09g33960.1 intron_variant ; MODIFIER silent_mutation Average:53.968; most accessible tissue: Callus, score: 73.122 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920049900 NA 1.24E-07 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920049900 NA 1.93E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920049900 NA 8.65E-19 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920049900 NA 1.28E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920049900 NA 4.96E-14 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920049900 NA 1.52E-14 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920049900 NA 1.03E-08 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920049900 2.25E-06 2.74E-28 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920049900 1.42E-07 8.21E-13 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920049900 NA 2.65E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920049900 4.64E-07 6.08E-34 mr1676 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920049900 1.78E-07 2.71E-14 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920049900 NA 5.78E-08 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920049900 NA 1.64E-29 mr1922 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920049900 NA 1.01E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920049900 NA 5.40E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920049900 NA 1.14E-14 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920049900 2.60E-08 1.95E-33 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920049900 2.37E-09 4.55E-18 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920049900 NA 8.88E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920049900 NA 2.81E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920049900 NA 1.95E-06 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251