\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920030283:

Variant ID: vg0920030283 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20030283
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 130. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAGAGGGCTGGATATCCCTGGGTATGAATAGGTTCAAATAAAAACAATATTTTTATGTTTTAAAGGAAAGACTAATTATGTTACGTGAATATGCTAGG[C/T]
TGTGTTTTTAAATAGAGGGGTTGACACGTACTGGTGTGAACAATAGGTTCGTACGAAATGTTCATGTGCAAAACACAGCCTGGAGTATTCAAGTAATCAA

Reverse complement sequence

TTGATTACTTGAATACTCCAGGCTGTGTTTTGCACATGAACATTTCGTACGAACCTATTGTTCACACCAGTACGTGTCAACCCCTCTATTTAAAAACACA[G/A]
CCTAGCATATTCACGTAACATAATTAGTCTTTCCTTTAAAACATAAAAATATTGTTTTTATTTGAACCTATTCATACCCAGGGATATCCAGCCCTCTTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 33.50% 0.08% 0.00% NA
All Indica  2759 95.30% 4.70% 0.00% 0.00% NA
All Japonica  1512 13.10% 86.60% 0.26% 0.00% NA
Aus  269 82.90% 17.10% 0.00% 0.00% NA
Indica I  595 97.00% 3.00% 0.00% 0.00% NA
Indica II  465 94.60% 5.40% 0.00% 0.00% NA
Indica III  913 97.60% 2.40% 0.00% 0.00% NA
Indica Intermediate  786 91.60% 8.40% 0.00% 0.00% NA
Temperate Japonica  767 15.10% 84.40% 0.52% 0.00% NA
Tropical Japonica  504 3.40% 96.60% 0.00% 0.00% NA
Japonica Intermediate  241 27.00% 73.00% 0.00% 0.00% NA
VI/Aromatic  96 58.30% 41.70% 0.00% 0.00% NA
Intermediate  90 40.00% 60.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920030283 C -> T LOC_Os09g33940.1 upstream_gene_variant ; 1658.0bp to feature; MODIFIER silent_mutation Average:56.111; most accessible tissue: Zhenshan97 root, score: 85.175 N N N N
vg0920030283 C -> T LOC_Os09g33930.1 downstream_gene_variant ; 2801.0bp to feature; MODIFIER silent_mutation Average:56.111; most accessible tissue: Zhenshan97 root, score: 85.175 N N N N
vg0920030283 C -> T LOC_Os09g33930.2 downstream_gene_variant ; 2801.0bp to feature; MODIFIER silent_mutation Average:56.111; most accessible tissue: Zhenshan97 root, score: 85.175 N N N N
vg0920030283 C -> T LOC_Os09g33930.3 downstream_gene_variant ; 2801.0bp to feature; MODIFIER silent_mutation Average:56.111; most accessible tissue: Zhenshan97 root, score: 85.175 N N N N
vg0920030283 C -> T LOC_Os09g33930.4 downstream_gene_variant ; 2801.0bp to feature; MODIFIER silent_mutation Average:56.111; most accessible tissue: Zhenshan97 root, score: 85.175 N N N N
vg0920030283 C -> T LOC_Os09g33930.5 downstream_gene_variant ; 2801.0bp to feature; MODIFIER silent_mutation Average:56.111; most accessible tissue: Zhenshan97 root, score: 85.175 N N N N
vg0920030283 C -> T LOC_Os09g33940.2 intron_variant ; MODIFIER silent_mutation Average:56.111; most accessible tissue: Zhenshan97 root, score: 85.175 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920030283 NA 2.91E-15 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 3.20E-16 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 6.66E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 1.30E-06 1.49E-08 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 9.45E-06 mr1269 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 6.34E-06 1.98E-20 mr1324 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 1.05E-12 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 1.15E-14 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 3.97E-16 mr1335 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 9.30E-23 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 5.84E-08 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 2.68E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 5.06E-15 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 1.52E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 3.40E-10 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 2.72E-15 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 4.74E-26 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 2.97E-08 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 1.97E-08 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 4.69E-14 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 1.80E-06 5.23E-31 mr1922 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 2.32E-13 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 3.75E-16 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 9.62E-15 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 2.18E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 1.65E-16 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 9.31E-09 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 8.73E-06 mr1156_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 2.48E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 6.79E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 3.40E-06 4.64E-26 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 3.44E-09 5.21E-13 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 1.62E-14 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283 NA 3.92E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251