Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920030283:

Variant ID: vg0920030283 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 20030283
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 130. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAGAGGGCTGGATATCCCTGGGTATGAATAGGTTCAAATAAAAACAATATTTTTATGTTTTAAAGGAAAGACTAATTATGTTACGTGAATATGCTAGG[C/T]
TGTGTTTTTAAATAGAGGGGTTGACACGTACTGGTGTGAACAATAGGTTCGTACGAAATGTTCATGTGCAAAACACAGCCTGGAGTATTCAAGTAATCAA

Reverse complement sequence

TTGATTACTTGAATACTCCAGGCTGTGTTTTGCACATGAACATTTCGTACGAACCTATTGTTCACACCAGTACGTGTCAACCCCTCTATTTAAAAACACA[G/A]
CCTAGCATATTCACGTAACATAATTAGTCTTTCCTTTAAAACATAAAAATATTGTTTTTATTTGAACCTATTCATACCCAGGGATATCCAGCCCTCTTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.50%	33.50%	0.08%	0.00%	NA
All Indica	2759	95.30%	4.70%	0.00%	0.00%	NA
All Japonica	1512	13.10%	86.60%	0.26%	0.00%	NA
Aus	269	82.90%	17.10%	0.00%	0.00%	NA
Indica I	595	97.00%	3.00%	0.00%	0.00%	NA
Indica II	465	94.60%	5.40%	0.00%	0.00%	NA
Indica III	913	97.60%	2.40%	0.00%	0.00%	NA
Indica Intermediate	786	91.60%	8.40%	0.00%	0.00%	NA
Temperate Japonica	767	15.10%	84.40%	0.52%	0.00%	NA
Tropical Japonica	504	3.40%	96.60%	0.00%	0.00%	NA
Japonica Intermediate	241	27.00%	73.00%	0.00%	0.00%	NA
VI/Aromatic	96	58.30%	41.70%	0.00%	0.00%	NA
Intermediate	90	40.00%	60.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0920030283	C -> T	LOC_Os09g33940.1	upstream_gene_variant ; 1658.0bp to feature; MODIFIER	silent_mutation	Average:56.111; most accessible tissue: Zhenshan97 root, score: 85.175	N	N	N	N
vg0920030283	C -> T	LOC_Os09g33930.1	downstream_gene_variant ; 2801.0bp to feature; MODIFIER	silent_mutation	Average:56.111; most accessible tissue: Zhenshan97 root, score: 85.175	N	N	N	N
vg0920030283	C -> T	LOC_Os09g33930.2	downstream_gene_variant ; 2801.0bp to feature; MODIFIER	silent_mutation	Average:56.111; most accessible tissue: Zhenshan97 root, score: 85.175	N	N	N	N
vg0920030283	C -> T	LOC_Os09g33930.3	downstream_gene_variant ; 2801.0bp to feature; MODIFIER	silent_mutation	Average:56.111; most accessible tissue: Zhenshan97 root, score: 85.175	N	N	N	N
vg0920030283	C -> T	LOC_Os09g33930.4	downstream_gene_variant ; 2801.0bp to feature; MODIFIER	silent_mutation	Average:56.111; most accessible tissue: Zhenshan97 root, score: 85.175	N	N	N	N
vg0920030283	C -> T	LOC_Os09g33930.5	downstream_gene_variant ; 2801.0bp to feature; MODIFIER	silent_mutation	Average:56.111; most accessible tissue: Zhenshan97 root, score: 85.175	N	N	N	N
vg0920030283	C -> T	LOC_Os09g33940.2	intron_variant ; MODIFIER	silent_mutation	Average:56.111; most accessible tissue: Zhenshan97 root, score: 85.175	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0920030283	NA	2.91E-15	mr1143	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	3.20E-16	mr1167	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	6.66E-11	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	1.30E-06	1.49E-08	mr1216	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	9.45E-06	mr1269	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	6.34E-06	1.98E-20	mr1324	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	1.05E-12	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	1.15E-14	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	3.97E-16	mr1335	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	9.30E-23	mr1518	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	5.84E-08	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	2.68E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	5.06E-15	mr1535	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	1.52E-10	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	3.40E-10	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	2.72E-15	mr1675	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	4.74E-26	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	2.97E-08	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	1.97E-08	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	4.69E-14	mr1726	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	1.80E-06	5.23E-31	mr1922	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	2.32E-13	mr1940	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	3.75E-16	mr1950	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	9.62E-15	mr1969	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	2.18E-09	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	1.65E-16	mr1995	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	9.31E-09	mr1050_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	8.73E-06	mr1156_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	2.48E-19	mr1167_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	6.79E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	3.40E-06	4.64E-26	mr1676_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	3.44E-09	5.21E-13	mr1676_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	1.62E-14	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920030283	NA	3.92E-09	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251