Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0920000635:

Variant ID: vg0920000635 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 20000635
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

TCCATTTCCCATTAGCCAAACATTGCCGGAGTGTTTTGCACGAAATTACCTTATAGGGGAGATTTAGGATGTGTTCGGTTGGAGGGATTTTCTAAGTTTG[T/G]
TTGGGTCGAGTCCATTTTCATAGATGTTTGGTTGTGAGATTAGGTATGATAGGATAATTCCAAAAGAGAATATATTCCACTAAAAAATGGGTTGAGTTAA

Reverse complement sequence

TTAACTCAACCCATTTTTTAGTGGAATATATTCTCTTTTGGAATTATCCTATCATACCTAATCTCACAACCAAACATCTATGAAAATGGACTCGACCCAA[A/C]
CAAACTTAGAAAATCCCTCCAACCGAACACATCCTAAATCTCCCCTATAAGGTAATTTCGTGCAAAACACTCCGGCAATGTTTGGCTAATGGGAAATGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.20%	26.60%	0.25%	0.00%	NA
All Indica	2759	97.90%	2.00%	0.04%	0.00%	NA
All Japonica	1512	25.50%	73.70%	0.73%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	97.80%	2.20%	0.00%	0.00%	NA
Indica II	465	95.30%	4.50%	0.22%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	97.30%	2.70%	0.00%	0.00%	NA
Temperate Japonica	767	7.80%	91.10%	1.04%	0.00%	NA
Tropical Japonica	504	59.30%	40.10%	0.60%	0.00%	NA
Japonica Intermediate	241	11.20%	88.80%	0.00%	0.00%	NA
VI/Aromatic	96	50.00%	50.00%	0.00%	0.00%	NA
Intermediate	90	61.10%	38.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0920000635	T -> G	LOC_Os09g33876.1	upstream_gene_variant ; 455.0bp to feature; MODIFIER	silent_mutation	Average:71.472; most accessible tissue: Minghui63 flag leaf, score: 84.028	N	N	N	N
vg0920000635	T -> G	LOC_Os09g33860.1	downstream_gene_variant ; 4767.0bp to feature; MODIFIER	silent_mutation	Average:71.472; most accessible tissue: Minghui63 flag leaf, score: 84.028	N	N	N	N
vg0920000635	T -> G	LOC_Os09g33870.1	downstream_gene_variant ; 841.0bp to feature; MODIFIER	silent_mutation	Average:71.472; most accessible tissue: Minghui63 flag leaf, score: 84.028	N	N	N	N
vg0920000635	T -> G	LOC_Os09g33870-LOC_Os09g33876	intergenic_region ; MODIFIER	silent_mutation	Average:71.472; most accessible tissue: Minghui63 flag leaf, score: 84.028	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0920000635	NA	1.22E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920000635	NA	3.61E-09	mr1693	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920000635	NA	9.71E-07	mr1742	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920000635	NA	3.08E-13	mr1853	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920000635	1.90E-06	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920000635	NA	1.31E-07	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251