\
| Variant ID: vg0919977401 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 19977401 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 69. )
ATCCGATTTTCGTCCATCAACCGAAAACCAAATGCAACGGGTCCCTCATCTATCAAAACCAGTGCAGATGAGGTCCCTCAGCGGTTTAGATGGCGGTTTT[A/G]
GCTGACGTGGCGCTTACGTGGCTAATTTGACTCGGTCTTCATCTGACGTAGCATTGATGTGACGCTTACGTGGCAATTCGATCCGAAAAATAATAAATCT
AGATTTATTATTTTTCGGATCGAATTGCCACGTAAGCGTCACATCAATGCTACGTCAGATGAAGACCGAGTCAAATTAGCCACGTAAGCGCCACGTCAGC[T/C]
AAAACCGCCATCTAAACCGCTGAGGGACCTCATCTGCACTGGTTTTGATAGATGAGGGACCCGTTGCATTTGGTTTTCGGTTGATGGACGAAAATCGGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.10% | 37.10% | 0.19% | 0.61% | NA |
| All Indica | 2759 | 94.30% | 4.40% | 0.29% | 1.05% | NA |
| All Japonica | 1512 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 82.90% | 17.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.60% | 2.50% | 0.67% | 1.18% | NA |
| Indica II | 465 | 93.50% | 5.40% | 0.22% | 0.86% | NA |
| Indica III | 913 | 96.30% | 1.90% | 0.11% | 1.75% | NA |
| Indica Intermediate | 786 | 91.30% | 8.10% | 0.25% | 0.25% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.00% | 98.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.80% | 94.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 50.00% | 50.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 38.90% | 60.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0919977401 | A -> G | LOC_Os09g33830.1 | upstream_gene_variant ; 2144.0bp to feature; MODIFIER | silent_mutation | Average:48.952; most accessible tissue: Zhenshan97 root, score: 79.452 | N | N | N | N |
| vg0919977401 | A -> G | LOC_Os09g33850.1 | downstream_gene_variant ; 3778.0bp to feature; MODIFIER | silent_mutation | Average:48.952; most accessible tissue: Zhenshan97 root, score: 79.452 | N | N | N | N |
| vg0919977401 | A -> G | LOC_Os09g33830-LOC_Os09g33850 | intergenic_region ; MODIFIER | silent_mutation | Average:48.952; most accessible tissue: Zhenshan97 root, score: 79.452 | N | N | N | N |
| vg0919977401 | A -> DEL | N | N | silent_mutation | Average:48.952; most accessible tissue: Zhenshan97 root, score: 79.452 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0919977401 | NA | 3.86E-12 | mr1172 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | 6.86E-07 | NA | mr1216 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | 2.24E-06 | 1.98E-08 | mr1216 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 2.68E-16 | mr1324 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 3.67E-11 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 1.60E-13 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 1.78E-13 | mr1335 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 1.45E-13 | mr1478 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 2.52E-06 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 3.84E-20 | mr1518 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 5.85E-06 | mr1518 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 4.75E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 1.96E-11 | mr1623 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 2.01E-09 | mr1660 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 1.04E-21 | mr1676 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 8.87E-07 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 1.08E-21 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 4.02E-28 | mr1922 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 3.39E-12 | mr1940 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 8.16E-15 | mr1950 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 1.74E-15 | mr1040_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 7.80E-06 | mr1064_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | 2.19E-07 | 6.38E-09 | mr1071_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | 3.88E-06 | NA | mr1080_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | 1.27E-08 | 3.51E-09 | mr1203_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 1.04E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 9.12E-10 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 2.80E-24 | mr1676_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | 3.44E-07 | 1.61E-10 | mr1676_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 1.36E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919977401 | NA | 1.29E-23 | mr1949_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |