Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919970662:

Variant ID: vg0919970662 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 19970662
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

TGGCTTCCACCCCGGGAGTGCCAAAAAAGGCTTGCGCAGCCTTATCCTCCAGATTTCTTGAGAAATATGGAAAGAGCAAACTAGCGGGTGTTCAGACACC[G/A]
GCAACATACCTAGTTGCCAAGATCAAAAGGAAGCAAAACCATAGACCTTGGCAAGAGCAAGGGCCCTCTCTAGTCTTGTTACTTAGGGTTTGTGTTTTTC

Reverse complement sequence

GAAAAACACAAACCCTAAGTAACAAGACTAGAGAGGGCCCTTGCTCTTGCCAAGGTCTATGGTTTTGCTTCCTTTTGATCTTGGCAACTAGGTATGTTGC[C/T]
GGTGTCTGAACACCCGCTAGTTTGCTCTTTCCATATTTCTCAAGAAATCTGGAGGATAAGGCTGCGCAAGCCTTTTTTGGCACTCCCGGGGTGGAAGCCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.00%	10.00%	0.02%	0.00%	NA
All Indica	2759	89.60%	10.40%	0.04%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	37.50%	62.50%	0.00%	0.00%	NA
Indica I	595	89.60%	10.40%	0.00%	0.00%	NA
Indica II	465	91.80%	8.20%	0.00%	0.00%	NA
Indica III	913	90.80%	9.20%	0.00%	0.00%	NA
Indica Intermediate	786	86.90%	13.00%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	86.70%	13.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0919970662	G -> A	LOC_Os09g33820.2	downstream_gene_variant ; 510.0bp to feature; MODIFIER	silent_mutation	Average:74.852; most accessible tissue: Minghui63 root, score: 83.939	N	N	N	N
vg0919970662	G -> A	LOC_Os09g33820.1	downstream_gene_variant ; 1579.0bp to feature; MODIFIER	silent_mutation	Average:74.852; most accessible tissue: Minghui63 root, score: 83.939	N	N	N	N
vg0919970662	G -> A	LOC_Os09g33820.3	downstream_gene_variant ; 511.0bp to feature; MODIFIER	silent_mutation	Average:74.852; most accessible tissue: Minghui63 root, score: 83.939	N	N	N	N
vg0919970662	G -> A	LOC_Os09g33830.1	intron_variant ; MODIFIER	silent_mutation	Average:74.852; most accessible tissue: Minghui63 root, score: 83.939	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0919970662	7.21E-11	4.36E-17	mr1216	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919970662	1.56E-10	2.62E-16	mr1216	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919970662	NA	2.19E-20	mr1817	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919970662	NA	9.36E-07	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919970662	7.07E-12	NA	mr1793_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919970662	3.68E-10	1.86E-13	mr1793_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919970662	NA	2.94E-18	mr1817_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919970662	NA	8.52E-06	mr1952_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251