\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919912392:

Variant ID: vg0919912392 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19912392
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.06, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGTGAAATATGTAAAACTATATGTACATTAAAGTATATTTAACAATGAATCAAATGATATGAAAAGAATAAATAATTATTTAAATTTTTTGAATAAGA[C/T]
GAATGGTCAAACACGTACTAAAAAGTCAACGGTGTCAAACATTTTGAAACGGAGGGAGTAGTAGTTAGTGGAGTAGTTAGTCAGTGGAGTAGTTAGTATG

Reverse complement sequence

CATACTAACTACTCCACTGACTAACTACTCCACTAACTACTACTCCCTCCGTTTCAAAATGTTTGACACCGTTGACTTTTTAGTACGTGTTTGACCATTC[G/A]
TCTTATTCAAAAAATTTAAATAATTATTTATTCTTTTCATATCATTTGATTCATTGTTAAATATACTTTAATGTACATATAGTTTTACATATTTCACAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.10% 12.80% 0.11% 0.00% NA
All Indica  2759 88.30% 11.60% 0.18% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 11.50% 88.50% 0.00% 0.00% NA
Indica I  595 89.60% 10.40% 0.00% 0.00% NA
Indica II  465 91.40% 8.40% 0.22% 0.00% NA
Indica III  913 89.40% 10.40% 0.22% 0.00% NA
Indica Intermediate  786 84.10% 15.60% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 74.00% 26.00% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919912392 C -> T LOC_Os09g33700.1 upstream_gene_variant ; 4349.0bp to feature; MODIFIER silent_mutation Average:63.881; most accessible tissue: Minghui63 root, score: 89.072 N N N N
vg0919912392 C -> T LOC_Os09g33710.1 intron_variant ; MODIFIER silent_mutation Average:63.881; most accessible tissue: Minghui63 root, score: 89.072 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919912392 NA 5.94E-16 mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919912392 6.40E-14 1.88E-18 mr1216 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919912392 3.36E-10 3.08E-16 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919912392 NA 1.60E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919912392 NA 7.14E-26 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919912392 NA 1.73E-12 mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919912392 NA 2.49E-08 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919912392 NA 2.20E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919912392 5.68E-07 NA mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919912392 1.29E-08 6.29E-12 mr1793_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919912392 2.62E-06 1.09E-23 mr1817_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251