\
| Variant ID: vg0919912392 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 19912392 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.06, others allele: 0.00, population size: 117. )
TTTGTGAAATATGTAAAACTATATGTACATTAAAGTATATTTAACAATGAATCAAATGATATGAAAAGAATAAATAATTATTTAAATTTTTTGAATAAGA[C/T]
GAATGGTCAAACACGTACTAAAAAGTCAACGGTGTCAAACATTTTGAAACGGAGGGAGTAGTAGTTAGTGGAGTAGTTAGTCAGTGGAGTAGTTAGTATG
CATACTAACTACTCCACTGACTAACTACTCCACTAACTACTACTCCCTCCGTTTCAAAATGTTTGACACCGTTGACTTTTTAGTACGTGTTTGACCATTC[G/A]
TCTTATTCAAAAAATTTAAATAATTATTTATTCTTTTCATATCATTTGATTCATTGTTAAATATACTTTAATGTACATATAGTTTTACATATTTCACAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.10% | 12.80% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 88.30% | 11.60% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 91.40% | 8.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 89.40% | 10.40% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 84.10% | 15.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 74.00% | 26.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0919912392 | C -> T | LOC_Os09g33700.1 | upstream_gene_variant ; 4349.0bp to feature; MODIFIER | silent_mutation | Average:63.881; most accessible tissue: Minghui63 root, score: 89.072 | N | N | N | N |
| vg0919912392 | C -> T | LOC_Os09g33710.1 | intron_variant ; MODIFIER | silent_mutation | Average:63.881; most accessible tissue: Minghui63 root, score: 89.072 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0919912392 | NA | 5.94E-16 | mr1158 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919912392 | 6.40E-14 | 1.88E-18 | mr1216 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919912392 | 3.36E-10 | 3.08E-16 | mr1216 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919912392 | NA | 1.60E-06 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919912392 | NA | 7.14E-26 | mr1817 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919912392 | NA | 1.73E-12 | mr1918 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919912392 | NA | 2.49E-08 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919912392 | NA | 2.20E-08 | mr1510_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919912392 | 5.68E-07 | NA | mr1793_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919912392 | 1.29E-08 | 6.29E-12 | mr1793_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919912392 | 2.62E-06 | 1.09E-23 | mr1817_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |