Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919908679:

Variant ID: vg0919908679 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19908679
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CATCGCCGAGCAAGCCATGACCGGGAGAAGAGAGAAAGGAGGGAGAGAGATGGAGAGCTGACATGTGGGTCCAAGGGTATTTTTGATATTTCACGCGATT[T/C]
CTCTCTCCTCTCCAACCGGAAAGTATTATTTTAATCGGCACGGTGTCCACTGGCAAATTACCATGTTTATGGAGTGTTTTCCCTCAAAAGTGAGTTTGGG

Reverse complement sequence

CCCAAACTCACTTTTGAGGGAAAACACTCCATAAACATGGTAATTTGCCAGTGGACACCGTGCCGATTAAAATAATACTTTCCGGTTGGAGAGGAGAGAG[A/G]
AATCGCGTGAAATATCAAAAATACCCTTGGACCCACATGTCAGCTCTCCATCTCTCTCCCTCCTTTCTCTCTTCTCCCGGTCATGGCTTGCTCGGCGATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 35.60% 0.06% 0.11% NA
All Indica  2759 96.30% 3.40% 0.07% 0.14% NA
All Japonica  1512 1.90% 98.10% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 97.10% 2.40% 0.17% 0.34% NA
Indica II  465 94.40% 5.40% 0.00% 0.22% NA
Indica III  913 99.10% 0.80% 0.00% 0.11% NA
Indica Intermediate  786 93.60% 6.20% 0.13% 0.00% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 2.00% 98.00% 0.00% 0.00% NA
Japonica Intermediate  241 6.20% 93.80% 0.00% 0.00% NA
VI/Aromatic  96 49.00% 51.00% 0.00% 0.00% NA
Intermediate  90 37.80% 60.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919908679 T -> DEL N N silent_mutation Average:80.875; most accessible tissue: Minghui63 panicle, score: 91.919 N N N N
vg0919908679 T -> C LOC_Os09g33710.1 3_prime_UTR_variant ; 444.0bp to feature; MODIFIER silent_mutation Average:80.875; most accessible tissue: Minghui63 panicle, score: 91.919 N N N N
vg0919908679 T -> C LOC_Os09g33690.1 upstream_gene_variant ; 4127.0bp to feature; MODIFIER silent_mutation Average:80.875; most accessible tissue: Minghui63 panicle, score: 91.919 N N N N
vg0919908679 T -> C LOC_Os09g33700.1 upstream_gene_variant ; 636.0bp to feature; MODIFIER silent_mutation Average:80.875; most accessible tissue: Minghui63 panicle, score: 91.919 N N N N
vg0919908679 T -> C LOC_Os09g33690.3 upstream_gene_variant ; 4205.0bp to feature; MODIFIER silent_mutation Average:80.875; most accessible tissue: Minghui63 panicle, score: 91.919 N N N N
vg0919908679 T -> C LOC_Os09g33690.2 upstream_gene_variant ; 4127.0bp to feature; MODIFIER silent_mutation Average:80.875; most accessible tissue: Minghui63 panicle, score: 91.919 N N N N
vg0919908679 T -> C LOC_Os09g33690.4 upstream_gene_variant ; 4127.0bp to feature; MODIFIER silent_mutation Average:80.875; most accessible tissue: Minghui63 panicle, score: 91.919 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0919908679 T C 0.01 0.01 0.0 0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919908679 NA 2.41E-17 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 NA 3.04E-12 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 NA 1.38E-07 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 NA 2.75E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 NA 8.11E-16 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 NA 8.48E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 NA 7.68E-31 mr1333 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 NA 4.52E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 NA 9.32E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 NA 4.79E-21 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 NA 2.83E-11 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 NA 8.09E-09 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 NA 1.10E-11 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 NA 3.78E-23 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 NA 3.72E-06 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 NA 7.39E-21 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 NA 5.81E-18 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 NA 2.96E-09 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 NA 5.03E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 NA 3.68E-07 mr1510_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 NA 3.49E-36 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 NA 1.51E-18 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 4.97E-07 7.19E-28 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 9.29E-07 1.52E-10 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 NA 1.28E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919908679 NA 2.51E-22 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251