Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0919907956:

Variant ID: vg0919907956 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19907956
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GCCGCCTCACCGTGCTCGACACGCTCGCCAACATCAGTTTGCTCGTCCTCGCCGGCGGGGATCTCGAGCGCCCTGGGGCGGGCGCGCCAGACGAACGCCG[C/T]
GCCACAAGCACGTCGAAGCTCGTCGCGCGGCCACGGAGGTGCGGTGGCGACGTCGCCGGGGCTGAAAGAAAAGGTGCGCATGACCATGTCGCCGGGGACC

Reverse complement sequence

GGTCCCCGGCGACATGGTCATGCGCACCTTTTCTTTCAGCCCCGGCGACGTCGCCACCGCACCTCCGTGGCCGCGCGACGAGCTTCGACGTGCTTGTGGC[G/A]
CGGCGTTCGTCTGGCGCGCCCGCCCCAGGGCGCTCGAGATCCCCGCCGGCGAGGACGAGCAAACTGATGTTGGCGAGCGTGTCGAGCACGGTGAGGCGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.20% 12.60% 0.15% 0.04% NA
All Indica  2759 88.30% 11.40% 0.25% 0.07% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 11.90% 88.10% 0.00% 0.00% NA
Indica I  595 89.60% 10.40% 0.00% 0.00% NA
Indica II  465 91.20% 8.60% 0.00% 0.22% NA
Indica III  913 89.50% 10.10% 0.44% 0.00% NA
Indica Intermediate  786 84.20% 15.30% 0.38% 0.13% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 74.00% 26.00% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919907956 C -> DEL LOC_Os09g33700.1 N frameshift_variant Average:84.201; most accessible tissue: Minghui63 panicle, score: 92.078 N N N N
vg0919907956 C -> T LOC_Os09g33700.1 missense_variant ; p.Ala30Thr; MODERATE nonsynonymous_codon ; A30T Average:84.201; most accessible tissue: Minghui63 panicle, score: 92.078 unknown unknown DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0919907956 C T -0.02 -0.02 -0.01 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919907956 NA 2.88E-22 mr1095 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919907956 NA 8.35E-16 mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919907956 2.65E-16 8.93E-20 mr1216 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919907956 1.56E-10 2.62E-16 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919907956 1.12E-06 3.99E-29 mr1817 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919907956 NA 2.28E-13 mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919907956 NA 7.38E-20 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919907956 NA 6.43E-23 mr1099_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919907956 NA 6.04E-08 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919907956 6.57E-10 NA mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919907956 3.68E-10 1.86E-13 mr1793_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919907956 NA 7.09E-23 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919907956 NA 8.52E-06 mr1952_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251