Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919898747:

Variant ID: vg0919898747 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 19898747
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

AGAGGGCGTTGTAAGCCGCGACCGCCTCGGCCGTGACCGGGCCCCTCTCCGGAACTAGGCCGAGCTTCCGCATCAGGTTGCGCTGGGCGCGCGACACTGC[G/A]
TGGATCGACCCCTCAAGCGCCTCAAGTGCCATCTTAGCAGCGATACGCTCACTGCGCTTCGGCACAACCTCCACCACCTTGGCGGCGAGAGGCGGCAGCG

Reverse complement sequence

CGCTGCCGCCTCTCGCCGCCAAGGTGGTGGAGGTTGTGCCGAAGCGCAGTGAGCGTATCGCTGCTAAGATGGCACTTGAGGCGCTTGAGGGGTCGATCCA[C/T]
GCAGTGTCGCGCGCCCAGCGCAACCTGATGCGGAAGCTCGGCCTAGTTCCGGAGAGGGGCCCGGTCACGGCCGAGGCGGTCGCGGCTTACAACGCCCTCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.80%	47.10%	0.02%	0.00%	NA
All Indica	2759	86.60%	13.30%	0.04%	0.00%	NA
All Japonica	1512	0.40%	99.60%	0.00%	0.00%	NA
Aus	269	29.40%	70.60%	0.00%	0.00%	NA
Indica I	595	93.60%	6.20%	0.17%	0.00%	NA
Indica II	465	85.40%	14.60%	0.00%	0.00%	NA
Indica III	913	89.90%	10.10%	0.00%	0.00%	NA
Indica Intermediate	786	78.20%	21.80%	0.00%	0.00%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	0.00%	100.00%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	20.00%	80.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0919898747	G -> A	LOC_Os09g33690.1	downstream_gene_variant ; 1757.0bp to feature; MODIFIER	silent_mutation	Average:64.296; most accessible tissue: Zhenshan97 flag leaf, score: 79.71	N	N	N	N
vg0919898747	G -> A	LOC_Os09g33690.3	downstream_gene_variant ; 1757.0bp to feature; MODIFIER	silent_mutation	Average:64.296; most accessible tissue: Zhenshan97 flag leaf, score: 79.71	N	N	N	N
vg0919898747	G -> A	LOC_Os09g33690.2	downstream_gene_variant ; 1757.0bp to feature; MODIFIER	silent_mutation	Average:64.296; most accessible tissue: Zhenshan97 flag leaf, score: 79.71	N	N	N	N
vg0919898747	G -> A	LOC_Os09g33690.4	downstream_gene_variant ; 1757.0bp to feature; MODIFIER	silent_mutation	Average:64.296; most accessible tissue: Zhenshan97 flag leaf, score: 79.71	N	N	N	N
vg0919898747	G -> A	LOC_Os09g33680-LOC_Os09g33690	intergenic_region ; MODIFIER	silent_mutation	Average:64.296; most accessible tissue: Zhenshan97 flag leaf, score: 79.71	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0919898747	NA	2.46E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898747	NA	8.73E-10	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898747	NA	1.70E-06	mr1185	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898747	NA	3.68E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898747	4.43E-15	1.36E-14	mr1216	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898747	2.43E-14	6.66E-26	mr1216	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898747	NA	1.34E-10	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898747	NA	1.64E-12	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898747	NA	2.18E-06	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898747	NA	3.30E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898747	NA	1.13E-07	mr1726	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898747	NA	4.29E-06	mr1742	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898747	NA	7.26E-13	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898747	NA	1.53E-29	mr1793	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898747	NA	3.76E-08	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898747	NA	5.71E-07	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898747	NA	3.09E-08	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898747	NA	3.86E-06	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898747	2.55E-07	2.28E-47	mr1793_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898747	NA	2.88E-14	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251