\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919898501:

Variant ID: vg0919898501 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19898501
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


AGACATGCTCATCACGGACTACATCACGCACAGCATCCCAACGGGCGCGCGAGTTCAGACCTCGCACGTTCCACACCAAAACGTTCTCGTTGCATGATCC[C/T]
ATTGTGGGGGACCACACCGAGAGCAGAAGAGAAGAAACCGATCAGCCGCACACGACCAACGCCTCTGCAGCCTTGGCCGGGGGCAAGGAGCTGGAGAAGA

Reverse complement sequence

TCTTCTCCAGCTCCTTGCCCCCGGCCAAGGCTGCAGAGGCGTTGGTCGTGTGCGGCTGATCGGTTTCTTCTCTTCTGCTCTCGGTGTGGTCCCCCACAAT[G/A]
GGATCATGCAACGAGAACGTTTTGGTGTGGAACGTGCGAGGTCTGAACTCGCGCGCCCGTTGGGATGCTGTGCGTGATGTAGTCCGTGATGAGCATGTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.70% 31.20% 0.02% 0.00% NA
All Indica  2759 47.00% 53.00% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 20.30% 79.70% 0.00% 0.00% NA
Indica II  465 70.10% 29.90% 0.00% 0.00% NA
Indica III  913 47.80% 52.20% 0.00% 0.00% NA
Indica Intermediate  786 52.50% 47.50% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 11.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919898501 C -> T LOC_Os09g33690.1 downstream_gene_variant ; 2003.0bp to feature; MODIFIER silent_mutation Average:45.066; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 N N N N
vg0919898501 C -> T LOC_Os09g33690.3 downstream_gene_variant ; 2003.0bp to feature; MODIFIER silent_mutation Average:45.066; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 N N N N
vg0919898501 C -> T LOC_Os09g33690.2 downstream_gene_variant ; 2003.0bp to feature; MODIFIER silent_mutation Average:45.066; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 N N N N
vg0919898501 C -> T LOC_Os09g33690.4 downstream_gene_variant ; 2003.0bp to feature; MODIFIER silent_mutation Average:45.066; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 N N N N
vg0919898501 C -> T LOC_Os09g33680-LOC_Os09g33690 intergenic_region ; MODIFIER silent_mutation Average:45.066; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919898501 NA 7.18E-08 mr1216 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898501 NA 4.08E-06 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898501 NA 9.23E-10 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898501 7.49E-07 7.18E-27 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898501 2.89E-06 4.61E-11 mr1598 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898501 NA 5.41E-07 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898501 NA 4.15E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898501 NA 4.96E-11 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898501 NA 1.27E-41 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898501 NA 2.99E-14 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898501 NA 3.70E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898501 NA 1.20E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898501 NA 2.39E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898501 NA 8.70E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898501 NA 5.06E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919898501 NA 8.61E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251