\
| Variant ID: vg0919898501 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 19898501 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 122. )
AGACATGCTCATCACGGACTACATCACGCACAGCATCCCAACGGGCGCGCGAGTTCAGACCTCGCACGTTCCACACCAAAACGTTCTCGTTGCATGATCC[C/T]
ATTGTGGGGGACCACACCGAGAGCAGAAGAGAAGAAACCGATCAGCCGCACACGACCAACGCCTCTGCAGCCTTGGCCGGGGGCAAGGAGCTGGAGAAGA
TCTTCTCCAGCTCCTTGCCCCCGGCCAAGGCTGCAGAGGCGTTGGTCGTGTGCGGCTGATCGGTTTCTTCTCTTCTGCTCTCGGTGTGGTCCCCCACAAT[G/A]
GGATCATGCAACGAGAACGTTTTGGTGTGGAACGTGCGAGGTCTGAACTCGCGCGCCCGTTGGGATGCTGTGCGTGATGTAGTCCGTGATGAGCATGTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.70% | 31.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 47.00% | 53.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 20.30% | 79.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 70.10% | 29.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 47.80% | 52.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 52.50% | 47.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 11.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0919898501 | C -> T | LOC_Os09g33690.1 | downstream_gene_variant ; 2003.0bp to feature; MODIFIER | silent_mutation | Average:45.066; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 | N | N | N | N |
| vg0919898501 | C -> T | LOC_Os09g33690.3 | downstream_gene_variant ; 2003.0bp to feature; MODIFIER | silent_mutation | Average:45.066; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 | N | N | N | N |
| vg0919898501 | C -> T | LOC_Os09g33690.2 | downstream_gene_variant ; 2003.0bp to feature; MODIFIER | silent_mutation | Average:45.066; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 | N | N | N | N |
| vg0919898501 | C -> T | LOC_Os09g33690.4 | downstream_gene_variant ; 2003.0bp to feature; MODIFIER | silent_mutation | Average:45.066; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 | N | N | N | N |
| vg0919898501 | C -> T | LOC_Os09g33680-LOC_Os09g33690 | intergenic_region ; MODIFIER | silent_mutation | Average:45.066; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0919898501 | NA | 7.18E-08 | mr1216 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919898501 | NA | 4.08E-06 | mr1216 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919898501 | NA | 9.23E-10 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919898501 | 7.49E-07 | 7.18E-27 | mr1598 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919898501 | 2.89E-06 | 4.61E-11 | mr1598 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919898501 | NA | 5.41E-07 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919898501 | NA | 4.15E-09 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919898501 | NA | 4.96E-11 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919898501 | NA | 1.27E-41 | mr1598_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919898501 | NA | 2.99E-14 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919898501 | NA | 3.70E-06 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919898501 | NA | 1.20E-06 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919898501 | NA | 2.39E-09 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919898501 | NA | 8.70E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919898501 | NA | 5.06E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919898501 | NA | 8.61E-06 | mr1856_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |