Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919897221:

Variant ID: vg0919897221 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 19897221
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

AAAACCGTCAGGACCGGGCGCCTTATCAGAGGGCAAGGACTTGATCACCGCCCAGACCTCATCCTCTGTGAAGGGACAGTCCAGTCCCTCAAGCTGCGCA[G/A]
GGCGGAGGCCAAGAGAGTGGAGGTCTAGGGCGAGTTCACGCTTGACGCTCGTCCCCAAGATGGCGCAAAAGTGAGAGGAGGCAAGCTCTTGCAGCGCATT

Reverse complement sequence

AATGCGCTGCAAGAGCTTGCCTCCTCTCACTTTTGCGCCATCTTGGGGACGAGCGTCAAGCGTGAACTCGCCCTAGACCTCCACTCTCTTGGCCTCCGCC[C/T]
TGCGCAGCTTGAGGGACTGGACTGTCCCTTCACAGAGGATGAGGTCTGGGCGGTGATCAAGTCCTTGCCCTCTGATAAGGCGCCCGGTCCTGACGGTTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.10%	46.80%	1.14%	0.00%	NA
All Indica	2759	84.30%	13.80%	1.92%	0.00%	NA
All Japonica	1512	0.60%	99.40%	0.00%	0.00%	NA
Aus	269	37.20%	62.50%	0.37%	0.00%	NA
Indica I	595	87.20%	7.40%	5.38%	0.00%	NA
Indica II	465	83.70%	15.10%	1.29%	0.00%	NA
Indica III	913	88.60%	11.00%	0.44%	0.00%	NA
Indica Intermediate	786	77.40%	21.20%	1.40%	0.00%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	0.00%	100.00%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	21.10%	78.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0919897221	G -> A	LOC_Os09g33690.1	downstream_gene_variant ; 3283.0bp to feature; MODIFIER	silent_mutation	Average:37.549; most accessible tissue: Zhenshan97 flag leaf, score: 71.238	N	N	N	N
vg0919897221	G -> A	LOC_Os09g33690.3	downstream_gene_variant ; 3283.0bp to feature; MODIFIER	silent_mutation	Average:37.549; most accessible tissue: Zhenshan97 flag leaf, score: 71.238	N	N	N	N
vg0919897221	G -> A	LOC_Os09g33690.2	downstream_gene_variant ; 3283.0bp to feature; MODIFIER	silent_mutation	Average:37.549; most accessible tissue: Zhenshan97 flag leaf, score: 71.238	N	N	N	N
vg0919897221	G -> A	LOC_Os09g33690.4	downstream_gene_variant ; 3283.0bp to feature; MODIFIER	silent_mutation	Average:37.549; most accessible tissue: Zhenshan97 flag leaf, score: 71.238	N	N	N	N
vg0919897221	G -> A	LOC_Os09g33680-LOC_Os09g33690	intergenic_region ; MODIFIER	silent_mutation	Average:37.549; most accessible tissue: Zhenshan97 flag leaf, score: 71.238	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0919897221	NA	1.14E-09	mr1216	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897221	NA	5.20E-10	mr1216	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897221	NA	9.06E-06	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897221	1.46E-08	NA	mr1793_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897221	6.38E-07	9.35E-09	mr1793_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251