Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919897205:

Variant ID: vg0919897205 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 19897205
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.77, C: 0.24, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

TGTAGAAACGGCCCGTAAAACCGTCAGGACCGGGCGCCTTATCAGAGGGCAAGGACTTGATCACCGCCCAGACCTCATCCTCTGTGAAGGGACAGTCCAG[T/C]
CCCTCAAGCTGCGCAGGGCGGAGGCCAAGAGAGTGGAGGTCTAGGGCGAGTTCACGCTTGACGCTCGTCCCCAAGATGGCGCAAAAGTGAGAGGAGGCAA

Reverse complement sequence

TTGCCTCCTCTCACTTTTGCGCCATCTTGGGGACGAGCGTCAAGCGTGAACTCGCCCTAGACCTCCACTCTCTTGGCCTCCGCCCTGCGCAGCTTGAGGG[A/G]
CTGGACTGTCCCTTCACAGAGGATGAGGTCTGGGCGGTGATCAAGTCCTTGCCCTCTGATAAGGCGCCCGGTCCTGACGGTTTTACGGGCCGTTTCTACA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.70%	40.30%	12.48%	0.49%	NA
All Indica	2759	14.00%	66.60%	18.59%	0.80%	NA
All Japonica	1512	99.50%	0.40%	0.13%	0.00%	NA
Aus	269	62.80%	16.70%	20.45%	0.00%	NA
Indica I	595	7.60%	70.60%	20.34%	1.51%	NA
Indica II	465	15.90%	72.70%	10.54%	0.86%	NA
Indica III	913	10.80%	68.60%	20.15%	0.44%	NA
Indica Intermediate	786	21.50%	57.60%	20.23%	0.64%	NA
Temperate Japonica	767	99.70%	0.10%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.10%	0.41%	0.00%	NA
VI/Aromatic	96	77.10%	5.20%	17.71%	0.00%	NA
Intermediate	90	81.10%	14.40%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0919897205	T -> DEL	N	N	silent_mutation	Average:37.152; most accessible tissue: Zhenshan97 flag leaf, score: 70.425	N	N	N	N
vg0919897205	T -> C	LOC_Os09g33690.1	downstream_gene_variant ; 3299.0bp to feature; MODIFIER	silent_mutation	Average:37.152; most accessible tissue: Zhenshan97 flag leaf, score: 70.425	N	N	N	N
vg0919897205	T -> C	LOC_Os09g33690.3	downstream_gene_variant ; 3299.0bp to feature; MODIFIER	silent_mutation	Average:37.152; most accessible tissue: Zhenshan97 flag leaf, score: 70.425	N	N	N	N
vg0919897205	T -> C	LOC_Os09g33690.2	downstream_gene_variant ; 3299.0bp to feature; MODIFIER	silent_mutation	Average:37.152; most accessible tissue: Zhenshan97 flag leaf, score: 70.425	N	N	N	N
vg0919897205	T -> C	LOC_Os09g33690.4	downstream_gene_variant ; 3299.0bp to feature; MODIFIER	silent_mutation	Average:37.152; most accessible tissue: Zhenshan97 flag leaf, score: 70.425	N	N	N	N
vg0919897205	T -> C	LOC_Os09g33680-LOC_Os09g33690	intergenic_region ; MODIFIER	silent_mutation	Average:37.152; most accessible tissue: Zhenshan97 flag leaf, score: 70.425	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0919897205	NA	5.76E-07	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	NA	1.42E-10	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	NA	4.61E-10	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	NA	2.06E-16	mr1165	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	NA	1.26E-11	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	NA	6.54E-07	mr1185	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	NA	4.93E-07	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	4.55E-17	1.38E-14	mr1216	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	1.19E-17	3.11E-30	mr1216	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	NA	2.41E-09	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	NA	2.07E-06	mr1324	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	NA	2.05E-12	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	NA	8.91E-15	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	NA	8.95E-06	mr1326	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	NA	3.14E-14	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	NA	1.97E-06	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	NA	9.98E-08	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	NA	1.27E-06	mr1532	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	NA	1.46E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	NA	5.04E-08	mr1726	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	NA	8.97E-15	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	NA	1.32E-31	mr1793	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	NA	5.44E-09	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	NA	4.42E-09	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	NA	1.49E-07	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	NA	5.59E-06	mr1676_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919897205	6.10E-07	2.59E-49	mr1793_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251