\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919892589:

Variant ID: vg0919892589 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19892589
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


CAACTCCTTAATCCATCTTGATATTTATGGTCATTATGTATGTTTTTTCTTTGCTATATAGTTTTGATAACAAATAAATAATCAAGTAACATGTGCGTAA[C/T]
AAACTTGACGTTACACTATAGATATTTGTCAAAATATAAACAATAATATAGTGCTTAGGAGATTATCTTGGTAGTATTCTTTAAAAAAATGACTTTGTCC

Reverse complement sequence

GGACAAAGTCATTTTTTTAAAGAATACTACCAAGATAATCTCCTAAGCACTATATTATTGTTTATATTTTGACAAATATCTATAGTGTAACGTCAAGTTT[G/A]
TTACGCACATGTTACTTGATTATTTATTTGTTATCAAAACTATATAGCAAAGAAAAAACATACATAATGACCATAAATATCAAGATGGATTAAGGAGTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.90% 17.30% 28.93% 16.84% NA
All Indica  2759 3.90% 27.10% 40.74% 28.31% NA
All Japonica  1512 99.30% 0.00% 0.53% 0.13% NA
Aus  269 0.70% 20.80% 76.58% 1.86% NA
Indica I  595 2.40% 13.10% 47.90% 36.64% NA
Indica II  465 6.00% 18.30% 30.11% 45.59% NA
Indica III  913 1.10% 41.40% 42.06% 15.44% NA
Indica Intermediate  786 7.00% 26.20% 40.08% 26.72% NA
Temperate Japonica  767 99.60% 0.00% 0.26% 0.13% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 97.50% 0.00% 2.07% 0.41% NA
VI/Aromatic  96 80.20% 7.30% 12.50% 0.00% NA
Intermediate  90 63.30% 8.90% 18.89% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919892589 C -> DEL N N silent_mutation Average:6.944; most accessible tissue: Zhenshan97 flower, score: 12.818 N N N N
vg0919892589 C -> T LOC_Os09g33680.1 upstream_gene_variant ; 4465.0bp to feature; MODIFIER silent_mutation Average:6.944; most accessible tissue: Zhenshan97 flower, score: 12.818 N N N N
vg0919892589 C -> T LOC_Os09g33680.2 upstream_gene_variant ; 4574.0bp to feature; MODIFIER silent_mutation Average:6.944; most accessible tissue: Zhenshan97 flower, score: 12.818 N N N N
vg0919892589 C -> T LOC_Os09g33680-LOC_Os09g33690 intergenic_region ; MODIFIER silent_mutation Average:6.944; most accessible tissue: Zhenshan97 flower, score: 12.818 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919892589 NA 5.63E-102 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 4.52E-100 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 2.15E-14 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 3.82E-19 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 2.82E-14 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 4.62E-12 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 3.13E-06 NA mr1216 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 6.71E-08 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 1.25E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 1.14E-15 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 1.17E-32 mr1333 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 1.14E-12 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 5.88E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 4.15E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 5.44E-22 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 6.06E-07 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 6.10E-11 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 1.48E-12 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 3.96E-24 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 4.77E-09 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 3.87E-26 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 8.43E-22 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 1.76E-33 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 2.11E-16 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 2.31E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 7.48E-16 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 7.46E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 6.66E-17 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 1.28E-09 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 1.28E-07 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 7.99E-06 4.82E-07 mr1399_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 6.05E-06 1.54E-27 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 4.74E-11 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 1.85E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 5.32E-06 mr1892_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919892589 NA 4.16E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251