\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919873160:

Variant ID: vg0919873160 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19873160
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


AGCCATCTATGCGTGTCGACGAACAGCAAAAGAATACACAAGAGAGAGAGAAGCAGCAGCTACAGCATGCACACATTTTATACTCCATCCATTTTAAAAT[G/A]
TTTAACACCATTGATTTTTAAGTACGTATTTGACCATTCGTCTTATTCAAAAAATTTAAGTAATTATTTATTCTTTTCATATCATTTGATTCATTGTTAA

Reverse complement sequence

TTAACAATGAATCAAATGATATGAAAAGAATAAATAATTACTTAAATTTTTTGAATAAGACGAATGGTCAAATACGTACTTAAAAATCAATGGTGTTAAA[C/T]
ATTTTAAAATGGATGGAGTATAAAATGTGTGCATGCTGTAGCTGCTGCTTCTCTCTCTCTTGTGTATTCTTTTGCTGTTCGTCGACACGCATAGATGGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.00% 33.00% 1.02% 0.00% NA
All Indica  2759 43.20% 56.00% 0.87% 0.00% NA
All Japonica  1512 99.60% 0.10% 0.26% 0.00% NA
Aus  269 93.70% 0.40% 5.95% 0.00% NA
Indica I  595 19.30% 80.20% 0.50% 0.00% NA
Indica II  465 69.00% 30.50% 0.43% 0.00% NA
Indica III  913 43.00% 56.20% 0.77% 0.00% NA
Indica Intermediate  786 46.10% 52.40% 1.53% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 0.00% 1.66% 0.00% NA
VI/Aromatic  96 95.80% 0.00% 4.17% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919873160 G -> A LOC_Os09g33650.1 upstream_gene_variant ; 1619.0bp to feature; MODIFIER silent_mutation Average:61.141; most accessible tissue: Minghui63 root, score: 92.419 N N N N
vg0919873160 G -> A LOC_Os09g33660.1 upstream_gene_variant ; 4307.0bp to feature; MODIFIER silent_mutation Average:61.141; most accessible tissue: Minghui63 root, score: 92.419 N N N N
vg0919873160 G -> A LOC_Os09g33640.1 downstream_gene_variant ; 4366.0bp to feature; MODIFIER silent_mutation Average:61.141; most accessible tissue: Minghui63 root, score: 92.419 N N N N
vg0919873160 G -> A LOC_Os09g33640-LOC_Os09g33650 intergenic_region ; MODIFIER silent_mutation Average:61.141; most accessible tissue: Minghui63 root, score: 92.419 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0919873160 G A 0.11 0.04 0.04 0.04 0.07 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919873160 NA 9.04E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919873160 NA 1.39E-06 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919873160 NA 5.72E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919873160 2.04E-07 7.13E-11 mr1216 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919873160 9.47E-07 8.02E-10 mr1216 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919873160 NA 2.65E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919873160 NA 2.38E-07 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919873160 NA 7.51E-09 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919873160 NA 6.23E-24 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919873160 NA 8.46E-09 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919873160 NA 3.52E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919873160 NA 5.44E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919873160 NA 3.51E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919873160 NA 2.87E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919873160 NA 3.13E-07 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919873160 NA 9.40E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919873160 NA 5.43E-10 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919873160 NA 1.03E-41 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919873160 NA 9.19E-14 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919873160 NA 5.84E-07 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919873160 NA 1.28E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919873160 NA 5.83E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919873160 NA 5.76E-06 mr1793_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251