\
| Variant ID: vg0919842296 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 19842296 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.17, others allele: 0.00, population size: 94. )
CGCCGGCCATACTCCACCAACCTAATTCCTCTTGGATACGACTAATCATCTGGTGTACTGTCGCCTCCTTTGCTCTAAAGATTCTTGCATTTCGTTCCTT[C/T]
CAGATTTCCCAAGCAATGAGCAAGAAGAGAGTTCTGAGTCCTTTCTGTTTTGTTGCTTCCAGGTCGCTTGTTCCTTGTGTCCACCAATCTAAGAGGTTTC
GAAACCTCTTAGATTGGTGGACACAAGGAACAAGCGACCTGGAAGCAACAAAACAGAAAGGACTCAGAACTCTCTTCTTGCTCATTGCTTGGGAAATCTG[G/A]
AAGGAACGAAATGCAAGAATCTTTAGAGCAAAGGAGGCGACAGTACACCAGATGATTAGTCGTATCCAAGAGGAATTAGGTTGGTGGAGTATGGCCGGCG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.60% | 40.00% | 2.50% | 4.93% | NA |
| All Indica | 2759 | 86.00% | 7.50% | 1.12% | 5.40% | NA |
| All Japonica | 1512 | 0.30% | 99.30% | 0.26% | 0.07% | NA |
| Aus | 269 | 31.20% | 11.50% | 28.62% | 28.62% | NA |
| Indica I | 595 | 96.30% | 2.90% | 0.00% | 0.84% | NA |
| Indica II | 465 | 86.90% | 6.70% | 0.43% | 6.02% | NA |
| Indica III | 913 | 85.40% | 8.20% | 0.88% | 5.48% | NA |
| Indica Intermediate | 786 | 78.20% | 10.70% | 2.67% | 8.40% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.00% | 99.80% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 0.80% | 97.50% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 91.70% | 3.12% | 2.08% | NA |
| Intermediate | 90 | 22.20% | 70.00% | 3.33% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0919842296 | C -> DEL | LOC_Os09g33610.1 | N | frameshift_variant | Average:33.018; most accessible tissue: Minghui63 root, score: 50.524 | N | N | N | N |
| vg0919842296 | C -> T | LOC_Os09g33610.1 | stop_gained ; p.Trp1939*; HIGH | stop_gained | Average:33.018; most accessible tissue: Minghui63 root, score: 50.524 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0919842296 | NA | 9.73E-06 | mr1002 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919842296 | NA | 3.08E-07 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919842296 | NA | 3.02E-07 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919842296 | NA | 1.02E-06 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919842296 | NA | 1.12E-09 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919842296 | NA | 4.36E-11 | mr1172 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919842296 | NA | 3.20E-06 | mr1185 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919842296 | NA | 2.06E-07 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919842296 | 4.25E-11 | 3.53E-12 | mr1216 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919842296 | 1.78E-09 | 5.84E-16 | mr1216 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919842296 | NA | 1.27E-10 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919842296 | NA | 1.25E-12 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919842296 | NA | 4.10E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919842296 | NA | 3.14E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919842296 | NA | 1.56E-06 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919842296 | NA | 1.28E-07 | mr1726 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919842296 | NA | 1.95E-08 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919842296 | NA | 1.24E-06 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919842296 | NA | 7.15E-09 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919842296 | NA | 5.35E-06 | mr1676_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919842296 | 1.90E-06 | NA | mr1793_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |