\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919836933:

Variant ID: vg0919836933 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19836933
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.24, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGAGCTCTTGCTAAGTTTCCTCCAAAACCTATATGCAACAAGCCATTCCATAGGAATTTTATAGGATTTGAAAAACTTCAATCCTTCGAATCAAAGGG[C/T]
TACATAGGAAAATTTCCTATAGGATTTCAATCCTATGAAATTCCTTCATAATTCCTTTGATTCAAAGGGGCCCTTAGTATTTTGATAAGTGTGATTATGA

Reverse complement sequence

TCATAATCACACTTATCAAAATACTAAGGGCCCCTTTGAATCAAAGGAATTATGAAGGAATTTCATAGGATTGAAATCCTATAGGAAATTTTCCTATGTA[G/A]
CCCTTTGATTCGAAGGATTGAAGTTTTTCAAATCCTATAAAATTCCTATGGAATGGCTTGTTGCATATAGGTTTTGGAGGAAACTTAGCAAGAGCTCCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.90% 47.70% 0.13% 0.28% NA
All Indica  2759 85.10% 14.20% 0.22% 0.43% NA
All Japonica  1512 0.40% 99.60% 0.00% 0.00% NA
Aus  269 29.00% 70.60% 0.00% 0.37% NA
Indica I  595 95.60% 3.90% 0.50% 0.00% NA
Indica II  465 85.80% 14.00% 0.00% 0.22% NA
Indica III  913 84.40% 15.10% 0.11% 0.33% NA
Indica Intermediate  786 77.60% 21.10% 0.25% 1.02% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 0.00% 100.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 21.10% 78.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919836933 C -> DEL N N silent_mutation Average:29.798; most accessible tissue: Minghui63 root, score: 50.524 N N N N
vg0919836933 C -> T LOC_Os09g33600-LOC_Os09g33610 intergenic_region ; MODIFIER silent_mutation Average:29.798; most accessible tissue: Minghui63 root, score: 50.524 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919836933 NA 3.34E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919836933 NA 7.34E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919836933 NA 9.53E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919836933 NA 1.97E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919836933 NA 5.56E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919836933 NA 1.02E-06 mr1185 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919836933 NA 2.17E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919836933 5.50E-16 1.39E-13 mr1216 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919836933 4.58E-14 3.47E-21 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919836933 NA 2.48E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919836933 NA 2.43E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919836933 NA 1.75E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919836933 NA 6.51E-07 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919836933 NA 1.95E-08 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919836933 NA 4.60E-14 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919836933 NA 4.62E-29 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919836933 NA 2.22E-08 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919836933 NA 3.17E-07 mr1950 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919836933 NA 1.71E-08 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919836933 NA 9.56E-10 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919836933 8.21E-07 9.94E-46 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251