\
| Variant ID: vg0919836933 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 19836933 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.24, others allele: 0.00, population size: 191. )
TTGGAGCTCTTGCTAAGTTTCCTCCAAAACCTATATGCAACAAGCCATTCCATAGGAATTTTATAGGATTTGAAAAACTTCAATCCTTCGAATCAAAGGG[C/T]
TACATAGGAAAATTTCCTATAGGATTTCAATCCTATGAAATTCCTTCATAATTCCTTTGATTCAAAGGGGCCCTTAGTATTTTGATAAGTGTGATTATGA
TCATAATCACACTTATCAAAATACTAAGGGCCCCTTTGAATCAAAGGAATTATGAAGGAATTTCATAGGATTGAAATCCTATAGGAAATTTTCCTATGTA[G/A]
CCCTTTGATTCGAAGGATTGAAGTTTTTCAAATCCTATAAAATTCCTATGGAATGGCTTGTTGCATATAGGTTTTGGAGGAAACTTAGCAAGAGCTCCAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.90% | 47.70% | 0.13% | 0.28% | NA |
| All Indica | 2759 | 85.10% | 14.20% | 0.22% | 0.43% | NA |
| All Japonica | 1512 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 29.00% | 70.60% | 0.00% | 0.37% | NA |
| Indica I | 595 | 95.60% | 3.90% | 0.50% | 0.00% | NA |
| Indica II | 465 | 85.80% | 14.00% | 0.00% | 0.22% | NA |
| Indica III | 913 | 84.40% | 15.10% | 0.11% | 0.33% | NA |
| Indica Intermediate | 786 | 77.60% | 21.10% | 0.25% | 1.02% | NA |
| Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 21.10% | 78.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0919836933 | C -> DEL | N | N | silent_mutation | Average:29.798; most accessible tissue: Minghui63 root, score: 50.524 | N | N | N | N |
| vg0919836933 | C -> T | LOC_Os09g33600-LOC_Os09g33610 | intergenic_region ; MODIFIER | silent_mutation | Average:29.798; most accessible tissue: Minghui63 root, score: 50.524 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0919836933 | NA | 3.34E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919836933 | NA | 7.34E-06 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919836933 | NA | 9.53E-06 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919836933 | NA | 1.97E-09 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919836933 | NA | 5.56E-11 | mr1172 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919836933 | NA | 1.02E-06 | mr1185 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919836933 | NA | 2.17E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919836933 | 5.50E-16 | 1.39E-13 | mr1216 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919836933 | 4.58E-14 | 3.47E-21 | mr1216 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919836933 | NA | 2.48E-09 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919836933 | NA | 2.43E-11 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919836933 | NA | 1.75E-13 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919836933 | NA | 6.51E-07 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919836933 | NA | 1.95E-08 | mr1726 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919836933 | NA | 4.60E-14 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919836933 | NA | 4.62E-29 | mr1793 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919836933 | NA | 2.22E-08 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919836933 | NA | 3.17E-07 | mr1950 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919836933 | NA | 1.71E-08 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919836933 | NA | 9.56E-10 | mr1676_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919836933 | 8.21E-07 | 9.94E-46 | mr1793_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |