\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919811255:

Variant ID: vg0919811255 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19811255
Reference Allele: CAlternative Allele: T,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, C: 0.37, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


TGCATCACCGTTGGAGACCAACGTTGAACCAAAGCAATCCTCTAATATACTCCTTCCGTCCCAAAAAAATCATTCTAGTATTCGTTATTATAGGAACGGC[C/T,A]
CATCCAATGCTAAATTGGTTTTATGTGGGATGGAGGGAGTATTATATACGCTAACTTCAGTTTTTCTTGTTATCAAGCACGATCACTTTGCTAATTTGCA

Reverse complement sequence

TGCAAATTAGCAAAGTGATCGTGCTTGATAACAAGAAAAACTGAAGTTAGCGTATATAATACTCCCTCCATCCCACATAAAACCAATTTAGCATTGGATG[G/A,T]
GCCGTTCCTATAATAACGAATACTAGAATGATTTTTTTGGGACGGAAGGAGTATATTAGAGGATTGCTTTGGTTCAACGTTGGTCTCCAACGGTGATGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.50% 44.20% 0.17% 0.02% A: 0.06%
All Indica  2759 89.20% 10.60% 0.11% 0.04% NA
All Japonica  1512 0.60% 99.10% 0.07% 0.00% A: 0.20%
Aus  269 42.40% 57.20% 0.37% 0.00% NA
Indica I  595 96.60% 3.40% 0.00% 0.00% NA
Indica II  465 86.50% 13.50% 0.00% 0.00% NA
Indica III  913 91.00% 8.90% 0.11% 0.00% NA
Indica Intermediate  786 83.20% 16.40% 0.25% 0.13% NA
Temperate Japonica  767 0.40% 99.50% 0.13% 0.00% NA
Tropical Japonica  504 0.00% 99.80% 0.00% 0.00% A: 0.20%
Japonica Intermediate  241 2.50% 96.70% 0.00% 0.00% A: 0.83%
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 30.00% 66.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919811255 C -> DEL N N silent_mutation Average:60.067; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0919811255 C -> T LOC_Os09g33580.1 downstream_gene_variant ; 1423.0bp to feature; MODIFIER silent_mutation Average:60.067; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0919811255 C -> T LOC_Os09g33580.2 downstream_gene_variant ; 1368.0bp to feature; MODIFIER silent_mutation Average:60.067; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0919811255 C -> T LOC_Os09g33559-LOC_Os09g33580 intergenic_region ; MODIFIER silent_mutation Average:60.067; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0919811255 C -> A LOC_Os09g33580.1 downstream_gene_variant ; 1423.0bp to feature; MODIFIER silent_mutation Average:60.067; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0919811255 C -> A LOC_Os09g33580.2 downstream_gene_variant ; 1368.0bp to feature; MODIFIER silent_mutation Average:60.067; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0919811255 C -> A LOC_Os09g33559-LOC_Os09g33580 intergenic_region ; MODIFIER silent_mutation Average:60.067; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919811255 NA 1.21E-13 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 5.78E-10 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 8.59E-16 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 2.79E-13 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 4.29E-07 mr1185 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 2.54E-14 2.08E-11 mr1216 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 4.06E-17 4.05E-28 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 2.86E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 2.69E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 7.58E-14 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 1.51E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 1.94E-07 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 5.18E-14 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 1.35E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 5.73E-07 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 2.63E-08 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 1.75E-13 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 1.45E-08 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 3.51E-13 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 2.76E-06 1.23E-32 mr1793 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 1.76E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 1.30E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 2.75E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 2.39E-14 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 1.25E-06 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 9.13E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 1.16E-07 1.51E-45 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 3.03E-07 mr1793_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919811255 NA 1.89E-15 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251