\
| Variant ID: vg0919811255 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 19811255 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, C: 0.37, others allele: 0.00, population size: 200. )
TGCATCACCGTTGGAGACCAACGTTGAACCAAAGCAATCCTCTAATATACTCCTTCCGTCCCAAAAAAATCATTCTAGTATTCGTTATTATAGGAACGGC[C/T,A]
CATCCAATGCTAAATTGGTTTTATGTGGGATGGAGGGAGTATTATATACGCTAACTTCAGTTTTTCTTGTTATCAAGCACGATCACTTTGCTAATTTGCA
TGCAAATTAGCAAAGTGATCGTGCTTGATAACAAGAAAAACTGAAGTTAGCGTATATAATACTCCCTCCATCCCACATAAAACCAATTTAGCATTGGATG[G/A,T]
GCCGTTCCTATAATAACGAATACTAGAATGATTTTTTTGGGACGGAAGGAGTATATTAGAGGATTGCTTTGGTTCAACGTTGGTCTCCAACGGTGATGCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.50% | 44.20% | 0.17% | 0.02% | A: 0.06% |
| All Indica | 2759 | 89.20% | 10.60% | 0.11% | 0.04% | NA |
| All Japonica | 1512 | 0.60% | 99.10% | 0.07% | 0.00% | A: 0.20% |
| Aus | 269 | 42.40% | 57.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 91.00% | 8.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 83.20% | 16.40% | 0.25% | 0.13% | NA |
| Temperate Japonica | 767 | 0.40% | 99.50% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 0.00% | 99.80% | 0.00% | 0.00% | A: 0.20% |
| Japonica Intermediate | 241 | 2.50% | 96.70% | 0.00% | 0.00% | A: 0.83% |
| VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 30.00% | 66.70% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0919811255 | C -> DEL | N | N | silent_mutation | Average:60.067; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0919811255 | C -> T | LOC_Os09g33580.1 | downstream_gene_variant ; 1423.0bp to feature; MODIFIER | silent_mutation | Average:60.067; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0919811255 | C -> T | LOC_Os09g33580.2 | downstream_gene_variant ; 1368.0bp to feature; MODIFIER | silent_mutation | Average:60.067; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0919811255 | C -> T | LOC_Os09g33559-LOC_Os09g33580 | intergenic_region ; MODIFIER | silent_mutation | Average:60.067; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0919811255 | C -> A | LOC_Os09g33580.1 | downstream_gene_variant ; 1423.0bp to feature; MODIFIER | silent_mutation | Average:60.067; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0919811255 | C -> A | LOC_Os09g33580.2 | downstream_gene_variant ; 1368.0bp to feature; MODIFIER | silent_mutation | Average:60.067; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0919811255 | C -> A | LOC_Os09g33559-LOC_Os09g33580 | intergenic_region ; MODIFIER | silent_mutation | Average:60.067; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0919811255 | NA | 1.21E-13 | mr1032 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 5.78E-10 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 8.59E-16 | mr1165 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 2.79E-13 | mr1172 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 4.29E-07 | mr1185 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | 2.54E-14 | 2.08E-11 | mr1216 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | 4.06E-17 | 4.05E-28 | mr1216 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 2.86E-09 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 2.69E-11 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 7.58E-14 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 1.51E-09 | mr1399 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 1.94E-07 | mr1399 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 5.18E-14 | mr1478 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 1.35E-06 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 5.73E-07 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 2.63E-08 | mr1535 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 1.75E-13 | mr1726 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 1.45E-08 | mr1726 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 3.51E-13 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | 2.76E-06 | 1.23E-32 | mr1793 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 1.76E-07 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 1.30E-06 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 2.75E-07 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 2.39E-14 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 1.25E-06 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 9.13E-08 | mr1399_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | 1.16E-07 | 1.51E-45 | mr1793_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 3.03E-07 | mr1793_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919811255 | NA | 1.89E-15 | mr1950_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |