\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919810818:

Variant ID: vg0919810818 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 19810818
Reference Allele: CAlternative Allele: T,A,CTT,CT
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGTGCCAGATCGTGATAAAGGCTCTATTTTTTTAATAAAAAGATAGTGGAATTTATTCTCATCTTTAGTTAATAACTAATTATTATAGAGGTTACAAAT[C/T,A,CTT,CT]
TTTTTTTTGCGGGGTACAGAGGTTACAAATCTAACGACTGTGAATTACAAATCTTCATATAGATAATTATGTTTAGAGTATAAGTGAATTACCCGATTTT

Reverse complement sequence

AAAATCGGGTAATTCACTTATACTCTAAACATAATTATCTATATGAAGATTTGTAATTCACAGTCGTTAGATTTGTAACCTCTGTACCCCGCAAAAAAAA[G/A,T,AAG,AG]
ATTTGTAACCTCTATAATAATTAGTTATTAACTAAAGATGAGAATAAATTCCACTATCTTTTTATTAAAAAAATAGAGCCTTTATCACGATCTGGCACAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.20% 43.60% 0.36% 0.00% CTT: 11.30%; A: 0.53%; CT: 0.02%
All Indica  2759 10.80% 70.00% 0.58% 0.00% CTT: 17.87%; A: 0.80%
All Japonica  1512 99.40% 0.30% 0.00% 0.00% CTT: 0.33%
Aus  269 57.20% 36.40% 0.00% 0.00% CTT: 5.20%; A: 1.12%
Indica I  595 3.50% 92.90% 1.85% 0.00% A: 1.01%; CTT: 0.67%
Indica II  465 13.30% 33.30% 0.22% 0.00% CTT: 52.69%; A: 0.43%
Indica III  913 8.90% 75.80% 0.11% 0.00% CTT: 14.46%; A: 0.77%
Indica Intermediate  786 17.00% 67.40% 0.38% 0.00% CTT: 14.25%; A: 0.89%
Temperate Japonica  767 99.60% 0.30% 0.00% 0.00% CTT: 0.13%
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 0.80% 0.00% 0.00% CTT: 1.66%
VI/Aromatic  96 74.00% 9.40% 1.04% 0.00% CTT: 15.62%
Intermediate  90 68.90% 22.20% 0.00% 0.00% CTT: 7.78%; CT: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919810818 C -> CT LOC_Os09g33580.1 downstream_gene_variant ; 1859.0bp to feature; MODIFIER silent_mutation Average:40.507; most accessible tissue: Callus, score: 77.227 N N N N
vg0919810818 C -> CT LOC_Os09g33580.2 downstream_gene_variant ; 1804.0bp to feature; MODIFIER silent_mutation Average:40.507; most accessible tissue: Callus, score: 77.227 N N N N
vg0919810818 C -> CT LOC_Os09g33559-LOC_Os09g33580 intergenic_region ; MODIFIER silent_mutation Average:40.507; most accessible tissue: Callus, score: 77.227 N N N N
vg0919810818 C -> T LOC_Os09g33580.1 downstream_gene_variant ; 1860.0bp to feature; MODIFIER silent_mutation Average:40.507; most accessible tissue: Callus, score: 77.227 N N N N
vg0919810818 C -> T LOC_Os09g33580.2 downstream_gene_variant ; 1805.0bp to feature; MODIFIER silent_mutation Average:40.507; most accessible tissue: Callus, score: 77.227 N N N N
vg0919810818 C -> T LOC_Os09g33559-LOC_Os09g33580 intergenic_region ; MODIFIER silent_mutation Average:40.507; most accessible tissue: Callus, score: 77.227 N N N N
vg0919810818 C -> CTT LOC_Os09g33580.1 downstream_gene_variant ; 1859.0bp to feature; MODIFIER silent_mutation Average:40.507; most accessible tissue: Callus, score: 77.227 N N N N
vg0919810818 C -> CTT LOC_Os09g33580.2 downstream_gene_variant ; 1804.0bp to feature; MODIFIER silent_mutation Average:40.507; most accessible tissue: Callus, score: 77.227 N N N N
vg0919810818 C -> CTT LOC_Os09g33559-LOC_Os09g33580 intergenic_region ; MODIFIER silent_mutation Average:40.507; most accessible tissue: Callus, score: 77.227 N N N N
vg0919810818 C -> A LOC_Os09g33580.1 downstream_gene_variant ; 1860.0bp to feature; MODIFIER silent_mutation Average:40.507; most accessible tissue: Callus, score: 77.227 N N N N
vg0919810818 C -> A LOC_Os09g33580.2 downstream_gene_variant ; 1805.0bp to feature; MODIFIER silent_mutation Average:40.507; most accessible tissue: Callus, score: 77.227 N N N N
vg0919810818 C -> A LOC_Os09g33559-LOC_Os09g33580 intergenic_region ; MODIFIER silent_mutation Average:40.507; most accessible tissue: Callus, score: 77.227 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919810818 NA 8.55E-07 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 3.16E-08 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 3.33E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 1.48E-15 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 1.71E-08 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 6.78E-16 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 2.37E-10 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 2.01E-16 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 3.74E-10 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 1.07E-06 mr1185 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 1.44E-07 mr1185 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 4.73E-07 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 2.37E-06 mr1189 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 1.91E-07 mr1216 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 5.47E-07 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 7.04E-06 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 1.52E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 2.71E-14 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 6.46E-11 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 3.64E-07 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 2.94E-08 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 1.31E-16 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 6.28E-11 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 3.86E-10 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 1.74E-06 2.63E-24 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 1.52E-06 7.60E-12 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 4.41E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 6.13E-06 mr1625 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 2.05E-15 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 3.26E-10 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 8.30E-06 mr1698 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 3.36E-07 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 4.18E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 6.85E-07 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 7.71E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 2.61E-14 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 7.84E-10 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 3.43E-06 mr1975 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 1.52E-06 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 4.78E-09 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 9.52E-07 mr1990 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 9.79E-10 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 2.95E-09 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 4.56E-09 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 1.74E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 1.38E-07 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 1.54E-12 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 1.08E-38 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 1.31E-16 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 6.65E-08 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 5.39E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 6.53E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 5.86E-07 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 1.81E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 8.55E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 4.59E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 5.85E-06 mr1856_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919810818 NA 1.42E-07 mr1949_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251