Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919789696:

Variant ID: vg0919789696 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 19789696
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

TGGGAAACTTCGTTTAGGGTGTGTTTAGTTAACGCTAAAATTAAAAGTTTGATTGAAATTGGAACGATGTGATGGAAAAGTTGGAAGTTTAAAGAAAAAA[G/T]
TTGAGGACTAAACCAGGCCTTAGTTTGTTCCTAGTACTGCATCAAATTTTGAAACTTTTAGGGCCTGTTTAGTTCCCGAGAGTGTCACATCGGAAGTTTG

Reverse complement sequence

CAAACTTCCGATGTGACACTCTCGGGAACTAAACAGGCCCTAAAAGTTTCAAAATTTGATGCAGTACTAGGAACAAACTAAGGCCTGGTTTAGTCCTCAA[C/A]
TTTTTTCTTTAAACTTCCAACTTTTCCATCACATCGTTCCAATTTCAATCAAACTTTTAATTTTAGCGTTAACTAAACACACCCTAAACGAAGTTTCCCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.40%	42.60%	0.04%	0.00%	NA
All Indica	2759	27.80%	72.10%	0.07%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	57.50%	42.50%	0.00%	0.00%	NA
Indica II	465	16.80%	83.20%	0.00%	0.00%	NA
Indica III	913	12.40%	87.50%	0.11%	0.00%	NA
Indica Intermediate	786	29.90%	70.00%	0.13%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0919789696	G -> T	LOC_Os09g33550.1	upstream_gene_variant ; 2919.0bp to feature; MODIFIER	silent_mutation	Average:54.395; most accessible tissue: Zhenshan97 flower, score: 68.734	N	N	N	N
vg0919789696	G -> T	LOC_Os09g33555.1	downstream_gene_variant ; 75.0bp to feature; MODIFIER	silent_mutation	Average:54.395; most accessible tissue: Zhenshan97 flower, score: 68.734	N	N	N	N
vg0919789696	G -> T	LOC_Os09g33555-LOC_Os09g33559	intergenic_region ; MODIFIER	silent_mutation	Average:54.395; most accessible tissue: Zhenshan97 flower, score: 68.734	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0919789696	NA	4.17E-06	mr1188	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919789696	3.07E-08	7.59E-12	mr1216	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919789696	9.18E-08	1.90E-11	mr1216	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919789696	NA	2.91E-09	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919789696	NA	1.62E-06	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919789696	NA	1.40E-08	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919789696	NA	5.08E-07	mr1532	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919789696	NA	2.75E-13	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251