\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919735674:

Variant ID: vg0919735674 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 19735674
Reference Allele: AAlternative Allele: G,AGT
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.04, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTGTTACGTGAAGCCTCGGTTTTCAGAAAATATCAGTTCTGTAAGAAAAAGCCGAATTAACCGGACCGGTTTTTCAGACCTGTTTTTTTTTTCTTCAC[A/G,AGT]
TCAAAATTGAAAGTTTGATTGAAATTGGAACGATATGATAGGAAAGTTAGAAGTTTATATGTGTAAAAAAAAGTTTTAATGGAACGGAAAAGTCGGATGT

Reverse complement sequence

ACATCCGACTTTTCCGTTCCATTAAAACTTTTTTTTACACATATAAACTTCTAACTTTCCTATCATATCGTTCCAATTTCAATCAAACTTTCAATTTTGA[T/C,ACT]
GTGAAGAAAAAAAAAACAGGTCTGAAAAACCGGTCCGGTTAATTCGGCTTTTTCTTACAGAACTGATATTTTCTGAAAACCGAGGCTTCACGTAACAGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.60% 34.10% 4.08% 1.06% AGT: 0.17%
All Indica  2759 43.00% 48.10% 6.89% 1.81% AGT: 0.29%
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 6.30% 93.30% 0.37% 0.00% NA
Indica I  595 11.30% 86.70% 1.68% 0.34% NA
Indica II  465 58.30% 38.10% 3.01% 0.65% NA
Indica III  913 54.50% 26.70% 13.80% 4.38% AGT: 0.55%
Indica Intermediate  786 44.40% 49.50% 5.09% 0.64% AGT: 0.38%
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 10.40% 1.04% 0.00% NA
Intermediate  90 77.80% 21.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919735674 A -> G LOC_Os09g33470.1 upstream_gene_variant ; 133.0bp to feature; MODIFIER silent_mutation Average:79.486; most accessible tissue: Minghui63 flag leaf, score: 96.597 N N N N
vg0919735674 A -> G LOC_Os09g33480.1 downstream_gene_variant ; 1445.0bp to feature; MODIFIER silent_mutation Average:79.486; most accessible tissue: Minghui63 flag leaf, score: 96.597 N N N N
vg0919735674 A -> G LOC_Os09g33470-LOC_Os09g33480 intergenic_region ; MODIFIER silent_mutation Average:79.486; most accessible tissue: Minghui63 flag leaf, score: 96.597 N N N N
vg0919735674 A -> DEL N N silent_mutation Average:79.486; most accessible tissue: Minghui63 flag leaf, score: 96.597 N N N N
vg0919735674 A -> AGT LOC_Os09g33470.1 upstream_gene_variant ; 134.0bp to feature; MODIFIER silent_mutation Average:79.486; most accessible tissue: Minghui63 flag leaf, score: 96.597 N N N N
vg0919735674 A -> AGT LOC_Os09g33480.1 downstream_gene_variant ; 1444.0bp to feature; MODIFIER silent_mutation Average:79.486; most accessible tissue: Minghui63 flag leaf, score: 96.597 N N N N
vg0919735674 A -> AGT LOC_Os09g33470-LOC_Os09g33480 intergenic_region ; MODIFIER silent_mutation Average:79.486; most accessible tissue: Minghui63 flag leaf, score: 96.597 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0919735674 A AGT -0.21 -0.15 -0.06 -0.11 -0.13 -0.13
vg0919735674 A G 0.01 0.0 0.01 0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919735674 NA 5.39E-10 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 3.68E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 1.17E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 8.00E-13 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 2.69E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 1.32E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 6.24E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 1.93E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 3.97E-10 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 5.26E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 6.66E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 2.24E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 3.71E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 2.47E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 4.08E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 3.84E-07 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 8.28E-11 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 4.38E-10 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 5.51E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 1.94E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 6.11E-08 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 6.25E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 7.67E-08 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 6.41E-09 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 2.28E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 1.08E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 2.61E-08 mr1832 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 1.39E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 4.27E-08 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 8.64E-10 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919735674 NA 5.23E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251