Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0919669819:

Variant ID: vg0919669819 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 19669819
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

AGTAGCGTCACAATTAATCATTTCTTGATACGTGAGATTTTTGTCCAAAAATCTCAATAATTTTAAAACTGGAGGTGAGCACCATATATAGGAGAGTGGT[A/G]
TTCGCAGGTCCAATAAATCCACAATACTATTATAATATTTTTCAAGCCTCCAAACTTCAACTAATTTGACACCGAGTGAGTAGGATCACAATTAATCATT

Reverse complement sequence

AATGATTAATTGTGATCCTACTCACTCGGTGTCAAATTAGTTGAAGTTTGGAGGCTTGAAAAATATTATAATAGTATTGTGGATTTATTGGACCTGCGAA[T/C]
ACCACTCTCCTATATATGGTGCTCACCTCCAGTTTTAAAATTATTGAGATTTTTGGACAAAAATCTCACGTATCAAGAAATGATTAATTGTGACGCTACT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.20%	35.80%	0.06%	0.00%	NA
All Indica	2759	39.30%	60.60%	0.11%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	80.30%	19.50%	0.17%	0.00%	NA
Indica II	465	35.10%	64.90%	0.00%	0.00%	NA
Indica III	913	13.50%	86.40%	0.11%	0.00%	NA
Indica Intermediate	786	40.60%	59.30%	0.13%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0919669819	A -> G	LOC_Os09g32960.1	upstream_gene_variant ; 1405.0bp to feature; MODIFIER	silent_mutation	Average:37.336; most accessible tissue: Callus, score: 75.964	N	N	N	N
vg0919669819	A -> G	LOC_Os09g32960.2	upstream_gene_variant ; 1400.0bp to feature; MODIFIER	silent_mutation	Average:37.336; most accessible tissue: Callus, score: 75.964	N	N	N	N
vg0919669819	A -> G	LOC_Os09g32960.3	upstream_gene_variant ; 1433.0bp to feature; MODIFIER	silent_mutation	Average:37.336; most accessible tissue: Callus, score: 75.964	N	N	N	N
vg0919669819	A -> G	LOC_Os09g32952.1	downstream_gene_variant ; 4551.0bp to feature; MODIFIER	silent_mutation	Average:37.336; most accessible tissue: Callus, score: 75.964	N	N	N	N
vg0919669819	A -> G	LOC_Os09g32956.1	downstream_gene_variant ; 2024.0bp to feature; MODIFIER	silent_mutation	Average:37.336; most accessible tissue: Callus, score: 75.964	N	N	N	N
vg0919669819	A -> G	LOC_Os09g32964.1	downstream_gene_variant ; 4747.0bp to feature; MODIFIER	silent_mutation	Average:37.336; most accessible tissue: Callus, score: 75.964	N	N	N	N
vg0919669819	A -> G	LOC_Os09g32956-LOC_Os09g32960	intergenic_region ; MODIFIER	silent_mutation	Average:37.336; most accessible tissue: Callus, score: 75.964	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0919669819	NA	6.15E-10	Heading_date	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0919669819	NA	9.79E-07	mr1216	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919669819	NA	6.80E-07	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919669819	NA	1.14E-08	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919669819	NA	8.39E-07	mr1697	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919669819	NA	3.33E-06	mr1697	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251