\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919669819:

Variant ID: vg0919669819 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19669819
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


AGTAGCGTCACAATTAATCATTTCTTGATACGTGAGATTTTTGTCCAAAAATCTCAATAATTTTAAAACTGGAGGTGAGCACCATATATAGGAGAGTGGT[A/G]
TTCGCAGGTCCAATAAATCCACAATACTATTATAATATTTTTCAAGCCTCCAAACTTCAACTAATTTGACACCGAGTGAGTAGGATCACAATTAATCATT

Reverse complement sequence

AATGATTAATTGTGATCCTACTCACTCGGTGTCAAATTAGTTGAAGTTTGGAGGCTTGAAAAATATTATAATAGTATTGTGGATTTATTGGACCTGCGAA[T/C]
ACCACTCTCCTATATATGGTGCTCACCTCCAGTTTTAAAATTATTGAGATTTTTGGACAAAAATCTCACGTATCAAGAAATGATTAATTGTGACGCTACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 35.80% 0.06% 0.00% NA
All Indica  2759 39.30% 60.60% 0.11% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 80.30% 19.50% 0.17% 0.00% NA
Indica II  465 35.10% 64.90% 0.00% 0.00% NA
Indica III  913 13.50% 86.40% 0.11% 0.00% NA
Indica Intermediate  786 40.60% 59.30% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919669819 A -> G LOC_Os09g32960.1 upstream_gene_variant ; 1405.0bp to feature; MODIFIER silent_mutation Average:37.336; most accessible tissue: Callus, score: 75.964 N N N N
vg0919669819 A -> G LOC_Os09g32960.2 upstream_gene_variant ; 1400.0bp to feature; MODIFIER silent_mutation Average:37.336; most accessible tissue: Callus, score: 75.964 N N N N
vg0919669819 A -> G LOC_Os09g32960.3 upstream_gene_variant ; 1433.0bp to feature; MODIFIER silent_mutation Average:37.336; most accessible tissue: Callus, score: 75.964 N N N N
vg0919669819 A -> G LOC_Os09g32952.1 downstream_gene_variant ; 4551.0bp to feature; MODIFIER silent_mutation Average:37.336; most accessible tissue: Callus, score: 75.964 N N N N
vg0919669819 A -> G LOC_Os09g32956.1 downstream_gene_variant ; 2024.0bp to feature; MODIFIER silent_mutation Average:37.336; most accessible tissue: Callus, score: 75.964 N N N N
vg0919669819 A -> G LOC_Os09g32964.1 downstream_gene_variant ; 4747.0bp to feature; MODIFIER silent_mutation Average:37.336; most accessible tissue: Callus, score: 75.964 N N N N
vg0919669819 A -> G LOC_Os09g32956-LOC_Os09g32960 intergenic_region ; MODIFIER silent_mutation Average:37.336; most accessible tissue: Callus, score: 75.964 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919669819 NA 6.15E-10 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0919669819 NA 9.79E-07 mr1216 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919669819 NA 6.80E-07 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919669819 NA 1.14E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919669819 NA 8.39E-07 mr1697 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919669819 NA 3.33E-06 mr1697 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251