\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919666357:

Variant ID: vg0919666357 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19666357
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACCAAACACTGACATCGATCTGCGGTTTTGGACGGCAGTTAATTCCTACAGACGGCAGCCTTCCCAAATTGGCAAGTTCGGCTGTGTCTGGGAGTCTAA[G/A]
GTGGTGTTTGGTTGGAGGGGCTAAATTGGGACTAAACTTTAGTCCCTCTCACAAAAATATAAGTCGAGAGACTAAATTTAGTCCCTAGTTCCCAAACACC

Reverse complement sequence

GGTGTTTGGGAACTAGGGACTAAATTTAGTCTCTCGACTTATATTTTTGTGAGAGGGACTAAAGTTTAGTCCCAATTTAGCCCCTCCAACCAAACACCAC[C/T]
TTAGACTCCCAGACACAGCCGAACTTGCCAATTTGGGAAGGCTGCCGTCTGTAGGAATTAACTGCCGTCCAAAACCGCAGATCGATGTCAGTGTTTGGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.90% 34.90% 4.97% 8.17% NA
All Indica  2759 21.90% 58.90% 7.03% 12.21% NA
All Japonica  1512 99.30% 0.40% 0.20% 0.07% NA
Aus  269 69.10% 0.40% 13.38% 17.10% NA
Indica I  595 35.30% 32.40% 20.34% 11.93% NA
Indica II  465 15.90% 69.20% 4.52% 10.32% NA
Indica III  913 11.50% 78.20% 0.88% 9.42% NA
Indica Intermediate  786 27.40% 50.30% 5.60% 16.79% NA
Temperate Japonica  767 99.60% 0.30% 0.00% 0.13% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 0.80% 1.24% 0.00% NA
VI/Aromatic  96 96.90% 0.00% 1.04% 2.08% NA
Intermediate  90 77.80% 21.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919666357 G -> DEL N N silent_mutation Average:93.653; most accessible tissue: Zhenshan97 flower, score: 98.214 N N N N
vg0919666357 G -> A LOC_Os09g32956.1 upstream_gene_variant ; 639.0bp to feature; MODIFIER silent_mutation Average:93.653; most accessible tissue: Zhenshan97 flower, score: 98.214 N N N N
vg0919666357 G -> A LOC_Os09g32960.1 upstream_gene_variant ; 4867.0bp to feature; MODIFIER silent_mutation Average:93.653; most accessible tissue: Zhenshan97 flower, score: 98.214 N N N N
vg0919666357 G -> A LOC_Os09g32960.2 upstream_gene_variant ; 4862.0bp to feature; MODIFIER silent_mutation Average:93.653; most accessible tissue: Zhenshan97 flower, score: 98.214 N N N N
vg0919666357 G -> A LOC_Os09g32960.3 upstream_gene_variant ; 4895.0bp to feature; MODIFIER silent_mutation Average:93.653; most accessible tissue: Zhenshan97 flower, score: 98.214 N N N N
vg0919666357 G -> A LOC_Os09g32952.1 downstream_gene_variant ; 1089.0bp to feature; MODIFIER silent_mutation Average:93.653; most accessible tissue: Zhenshan97 flower, score: 98.214 N N N N
vg0919666357 G -> A LOC_Os09g32952-LOC_Os09g32956 intergenic_region ; MODIFIER silent_mutation Average:93.653; most accessible tissue: Zhenshan97 flower, score: 98.214 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0919666357 G A 0.0 0.0 0.0 -0.01 0.01 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919666357 4.86E-07 9.56E-10 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919666357 NA 2.87E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919666357 NA 2.91E-15 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919666357 NA 1.35E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919666357 NA 2.55E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919666357 NA 9.26E-21 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919666357 NA 5.20E-08 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919666357 NA 1.54E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919666357 NA 4.52E-28 mr1546 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919666357 NA 1.87E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919666357 NA 5.40E-22 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919666357 NA 9.69E-10 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919666357 NA 6.79E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919666357 NA 3.22E-06 mr1064_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919666357 NA 2.23E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919666357 NA 1.48E-09 mr1398_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919666357 NA 7.58E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919666357 NA 4.27E-24 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919666357 4.11E-06 9.07E-12 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919666357 NA 2.61E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919666357 NA 5.79E-07 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251