\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919506914:

Variant ID: vg0919506914 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19506914
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, C: 0.07, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CAGAAGCGGGAGGGATTGGAGATTCCGCACCTGCTCGAATCCTCGATCCAGCCGCGCGGCTCGATGAGGAGGAGACCGCGATTTTTTTCTTCTTTTTTTT[T/C]
CTTTTTTTTTTATCTTGACCGCGATTTATTTCAATTTCAACACGAGTGAAGAGAGAAGAAGAGGAGAGGTCGTTTCCCATTCTTCTCCTCCTGTTTAAAA

Reverse complement sequence

TTTTAAACAGGAGGAGAAGAATGGGAAACGACCTCTCCTCTTCTTCTCTCTTCACTCGTGTTGAAATTGAAATAAATCGCGGTCAAGATAAAAAAAAAAG[A/G]
AAAAAAAAGAAGAAAAAAATCGCGGTCTCCTCCTCATCGAGCCGCGCGGCTGGATCGAGGATTCGAGCAGGTGCGGAATCTCCAATCCCTCCCGCTTCTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.00% 19.60% 1.95% 0.44% NA
All Indica  2759 70.50% 27.40% 2.14% 0.00% NA
All Japonica  1512 97.00% 0.30% 1.39% 1.32% NA
Aus  269 48.30% 49.10% 2.60% 0.00% NA
Indica I  595 56.50% 37.60% 5.88% 0.00% NA
Indica II  465 95.30% 4.30% 0.43% 0.00% NA
Indica III  913 64.50% 34.80% 0.66% 0.00% NA
Indica Intermediate  786 73.30% 24.70% 2.04% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 91.70% 0.40% 3.97% 3.97% NA
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 78.10% 20.80% 1.04% 0.00% NA
Intermediate  90 77.80% 16.70% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919506914 T -> DEL N N silent_mutation Average:99.021; most accessible tissue: Minghui63 young leaf, score: 99.677 N N N N
vg0919506914 T -> C LOC_Os09g32690.1 5_prime_UTR_variant ; 831.0bp to feature; MODIFIER silent_mutation Average:99.021; most accessible tissue: Minghui63 young leaf, score: 99.677 N N N N
vg0919506914 T -> C LOC_Os09g32690.3 5_prime_UTR_variant ; 831.0bp to feature; MODIFIER silent_mutation Average:99.021; most accessible tissue: Minghui63 young leaf, score: 99.677 N N N N
vg0919506914 T -> C LOC_Os09g32690.2 5_prime_UTR_variant ; 831.0bp to feature; MODIFIER silent_mutation Average:99.021; most accessible tissue: Minghui63 young leaf, score: 99.677 N N N N
vg0919506914 T -> C LOC_Os09g32700.1 upstream_gene_variant ; 134.0bp to feature; MODIFIER silent_mutation Average:99.021; most accessible tissue: Minghui63 young leaf, score: 99.677 N N N N
vg0919506914 T -> C LOC_Os09g32680.1 downstream_gene_variant ; 3781.0bp to feature; MODIFIER silent_mutation Average:99.021; most accessible tissue: Minghui63 young leaf, score: 99.677 N N N N
vg0919506914 T -> C LOC_Os09g32710.1 downstream_gene_variant ; 2322.0bp to feature; MODIFIER silent_mutation Average:99.021; most accessible tissue: Minghui63 young leaf, score: 99.677 N N N N
vg0919506914 T -> C LOC_Os09g32680.2 downstream_gene_variant ; 3781.0bp to feature; MODIFIER silent_mutation Average:99.021; most accessible tissue: Minghui63 young leaf, score: 99.677 N N N N
vg0919506914 T -> C LOC_Os09g32680.3 downstream_gene_variant ; 3781.0bp to feature; MODIFIER silent_mutation Average:99.021; most accessible tissue: Minghui63 young leaf, score: 99.677 N N N N
vg0919506914 T -> C LOC_Os09g32680.4 downstream_gene_variant ; 3781.0bp to feature; MODIFIER silent_mutation Average:99.021; most accessible tissue: Minghui63 young leaf, score: 99.677 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0919506914 T C -0.02 -0.02 -0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919506914 NA 2.88E-07 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919506914 NA 8.67E-11 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919506914 NA 4.57E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919506914 NA 9.49E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919506914 NA 7.65E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919506914 NA 8.72E-13 mr1660 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919506914 NA 1.78E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919506914 NA 4.81E-21 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919506914 NA 1.61E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919506914 NA 1.46E-13 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919506914 NA 5.54E-11 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919506914 NA 1.40E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919506914 NA 5.24E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919506914 NA 1.17E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919506914 NA 6.19E-18 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251