\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919423685:

Variant ID: vg0919423685 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19423685
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.05, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CAATCCGAATAGGAATAAGTTCACTTTTAGGTCCACTCGCTTGCATGTTACTCCCCGTCCCATTTTGCAGTCGCGGTTTCCGTGTCTAATATTTAATCGT[T/C]
CGTATTATTTAAAATTTTTTTAAAAAAATAAGTTATACATAAAGTACTATTTATGTCTTATCATCTAATAACAACAAAAATACAAGCAAATTTTGCCTAA

Reverse complement sequence

TTAGGCAAAATTTGCTTGTATTTTTGTTGTTATTAGATGATAAGACATAAATAGTACTTTATGTATAACTTATTTTTTTAAAAAAATTTTAAATAATACG[A/G]
ACGATTAAATATTAGACACGGAAACCGCGACTGCAAAATGGGACGGGGAGTAACATGCAAGCGAGTGGACCTAAAAGTGAACTTATTCCTATTCGGATTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.10% 47.20% 0.63% 0.00% NA
All Indica  2759 60.60% 39.10% 0.36% 0.00% NA
All Japonica  1512 48.90% 49.80% 1.26% 0.00% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 18.80% 81.20% 0.00% 0.00% NA
Indica II  465 68.20% 31.40% 0.43% 0.00% NA
Indica III  913 86.50% 13.00% 0.44% 0.00% NA
Indica Intermediate  786 57.50% 42.00% 0.51% 0.00% NA
Temperate Japonica  767 80.40% 17.10% 2.48% 0.00% NA
Tropical Japonica  504 8.10% 91.90% 0.00% 0.00% NA
Japonica Intermediate  241 34.00% 66.00% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 42.20% 56.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919423685 T -> C LOC_Os09g32532.1 upstream_gene_variant ; 2601.0bp to feature; MODIFIER silent_mutation Average:65.288; most accessible tissue: Callus, score: 80.133 N N N N
vg0919423685 T -> C LOC_Os09g32532.2 upstream_gene_variant ; 2607.0bp to feature; MODIFIER silent_mutation Average:65.288; most accessible tissue: Callus, score: 80.133 N N N N
vg0919423685 T -> C LOC_Os09g32540.1 downstream_gene_variant ; 1272.0bp to feature; MODIFIER silent_mutation Average:65.288; most accessible tissue: Callus, score: 80.133 N N N N
vg0919423685 T -> C LOC_Os09g32532-LOC_Os09g32540 intergenic_region ; MODIFIER silent_mutation Average:65.288; most accessible tissue: Callus, score: 80.133 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919423685 NA 1.17E-13 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0919423685 NA 1.66E-17 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0919423685 NA 2.82E-16 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0919423685 NA 1.21E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 8.80E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 6.64E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 1.74E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 1.27E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 1.35E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 2.41E-09 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 4.27E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 6.06E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 1.78E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 9.91E-10 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 5.30E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 6.55E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 1.76E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 1.03E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 7.12E-09 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 8.18E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 4.14E-06 mr1388_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 9.84E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 1.66E-08 mr1554_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 1.79E-18 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 2.67E-09 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 9.83E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 4.76E-07 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 8.08E-10 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 9.95E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919423685 NA 3.26E-09 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251