\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919270981:

Variant ID: vg0919270981 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 19270981
Reference Allele: CAAAAlternative Allele: TAAA,CA,CAAAA,CAA,C
Primary Allele: CAAASecondary Allele: TAAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTTTCAATTTCAACAAAACTTTCAATTTTGGTGTGAACTAAACACAGCCCAAACTGATTTGATTACGCTGAACTTTAACAAGTCCAAGTCCAGTCCCTG[CAAA/TAAA,CA,CAAAA,CAA,C]
AAAAAAAAAAACAAGTCCAAGTCCAGGTCAAGTCAATGGTGCCAAGTGCCCACTGTGCACAGGACCGGCCTGATTTTTCCTTCTGAAAATTACACCAACA

Reverse complement sequence

TGTTGGTGTAATTTTCAGAAGGAAAAATCAGGCCGGTCCTGTGCACAGTGGGCACTTGGCACCATTGACTTGACCTGGACTTGGACTTGTTTTTTTTTTT[TTTG/TTTA,TG,TTTTG,TTG,G]
CAGGGACTGGACTTGGACTTGTTAAAGTTCAGCGTAATCAAATCAGTTTGGGCTGTGTTTAGTTCACACCAAAATTGAAAGTTTTGTTGAAATTGAAACG

Allele Frequencies:

Populations Population SizeFrequency of CAAA(primary allele) Frequency of TAAA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.10% 27.30% 4.04% 0.76% CA: 20.50%; CAA: 0.63%; CAAAA: 0.53%; C: 0.11%
All Indica  2759 27.40% 46.20% 1.34% 0.36% CA: 24.65%; CAA: 0.11%
All Japonica  1512 86.60% 0.10% 9.06% 1.52% CAAAA: 1.59%; CAA: 0.93%; CA: 0.26%
Aus  269 16.70% 0.40% 1.49% 0.74% CA: 77.32%; C: 1.86%; CAA: 1.49%
Indica I  595 10.30% 24.90% 2.52% 0.17% CA: 61.85%; CAA: 0.34%
Indica II  465 19.40% 71.00% 0.86% 0.43% CA: 8.39%
Indica III  913 36.10% 50.50% 0.55% 0.33% CA: 12.38%; CAA: 0.11%
Indica Intermediate  786 34.90% 42.60% 1.65% 0.51% CA: 20.36%
Temperate Japonica  767 84.20% 0.00% 12.26% 2.48% CAAAA: 0.52%; CAA: 0.39%; CA: 0.13%
Tropical Japonica  504 89.30% 0.00% 4.76% 0.60% CAAAA: 3.17%; CAA: 1.98%; CA: 0.20%
Japonica Intermediate  241 88.40% 0.40% 7.88% 0.41% CAAAA: 1.66%; CA: 0.83%; CAA: 0.41%
VI/Aromatic  96 28.10% 0.00% 5.21% 1.04% CA: 55.21%; CAA: 9.38%; CAAAA: 1.04%
Intermediate  90 47.80% 16.70% 8.89% 0.00% CA: 26.67%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919270981 CAAA -> DEL N N silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> CA LOC_Os09g32274.1 downstream_gene_variant ; 3302.0bp to feature; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> CA LOC_Os09g32280.1 downstream_gene_variant ; 551.0bp to feature; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> CA LOC_Os09g32290.2 downstream_gene_variant ; 1324.0bp to feature; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> CA LOC_Os09g32290.1 downstream_gene_variant ; 1324.0bp to feature; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> CA LOC_Os09g32280-LOC_Os09g32290 intergenic_region ; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> C LOC_Os09g32274.1 downstream_gene_variant ; 3301.0bp to feature; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> C LOC_Os09g32280.1 downstream_gene_variant ; 550.0bp to feature; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> C LOC_Os09g32290.2 downstream_gene_variant ; 1325.0bp to feature; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> C LOC_Os09g32290.1 downstream_gene_variant ; 1325.0bp to feature; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> C LOC_Os09g32280-LOC_Os09g32290 intergenic_region ; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> CAAAA LOC_Os09g32274.1 downstream_gene_variant ; 3304.0bp to feature; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> CAAAA LOC_Os09g32280.1 downstream_gene_variant ; 553.0bp to feature; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> CAAAA LOC_Os09g32290.2 downstream_gene_variant ; 1322.0bp to feature; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> CAAAA LOC_Os09g32290.1 downstream_gene_variant ; 1322.0bp to feature; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> CAAAA LOC_Os09g32280-LOC_Os09g32290 intergenic_region ; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> TAAA LOC_Os09g32274.1 downstream_gene_variant ; 3300.0bp to feature; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> TAAA LOC_Os09g32280.1 downstream_gene_variant ; 549.0bp to feature; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> TAAA LOC_Os09g32290.2 downstream_gene_variant ; 1326.0bp to feature; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> TAAA LOC_Os09g32290.1 downstream_gene_variant ; 1326.0bp to feature; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> TAAA LOC_Os09g32280-LOC_Os09g32290 intergenic_region ; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> CAA LOC_Os09g32274.1 downstream_gene_variant ; 3303.0bp to feature; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> CAA LOC_Os09g32280.1 downstream_gene_variant ; 552.0bp to feature; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> CAA LOC_Os09g32290.2 downstream_gene_variant ; 1323.0bp to feature; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> CAA LOC_Os09g32290.1 downstream_gene_variant ; 1323.0bp to feature; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N
vg0919270981 CAAA -> CAA LOC_Os09g32280-LOC_Os09g32290 intergenic_region ; MODIFIER silent_mutation Average:89.464; most accessible tissue: Zhenshan97 young leaf, score: 98.358 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0919270981 CAAA C 0.1 0.28 0.15 -0.31 -0.11 -0.16
vg0919270981 CAAA CA 0.09 0.15 0.03 -0.11 0.07 0.23
vg0919270981 CAAA CAA 0.01 0.14 0.08 -0.06 0.09 0.24
vg0919270981 CAAA CAAAA 0.08 0.33 0.1 0.03 0.17 0.22
vg0919270981 CAAA TAAA -0.03 0.05 0.07 -0.05 -0.01 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919270981 NA 9.43E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919270981 NA 2.07E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919270981 NA 8.79E-09 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919270981 NA 1.11E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919270981 3.89E-06 7.23E-09 mr1707 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919270981 NA 1.60E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919270981 NA 2.69E-11 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251