Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0919233052:

Variant ID: vg0919233052 (JBrowse)	Variation Type: INDEL
Chromosome: chr09	Position: 19233052
Reference Allele: T	Alternative Allele: A,TAAA,TA,TAA,TTAA
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, A: 0.30, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

TCAAAATCCTGTAAATTTCACTTTCTGTGTCATTGTAACTGAAGTCCTAGACAGCAACGGGTTGTTTGAATATCTGGTTTGACCAAAGCTCATTTTTTTT[T/A,TAAA,TA,TAA,TTAA]
AAAAAAAACAGATAGAAGTCTACCAACCTAGAATTTGTTTTGTTTGTTAGGATCTCGTGACCTAAGAAAGTGGGGATAATCTGGTGAAGAAAAAAAAACT

Reverse complement sequence

AGTTTTTTTTTCTTCACCAGATTATCCCCACTTTCTTAGGTCACGAGATCCTAACAAACAAAACAAATTCTAGGTTGGTAGACTTCTATCTGTTTTTTTT[A/T,TTTA,TA,TTA,TTAA]
AAAAAAAATGAGCTTTGGTCAAACCAGATATTCAAACAACCCGTTGCTGTCTAGGACTTCAGTTACAATGACACAGAAAGTGAAATTTACAGGATTTTGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.80%	26.80%	1.71%	0.00%	TAA: 0.30%; TA: 0.15%; TAAA: 0.15%; TTAA: 0.04%
All Indica	2759	96.70%	2.40%	0.33%	0.00%	TAA: 0.51%; TA: 0.07%; TAAA: 0.04%
All Japonica	1512	19.90%	75.50%	4.50%	0.00%	TA: 0.07%; TAAA: 0.07%
Aus	269	94.80%	3.70%	0.00%	0.00%	TA: 1.49%
Indica I	595	97.10%	2.40%	0.17%	0.00%	TAAA: 0.17%; TAA: 0.17%
Indica II	465	94.80%	4.50%	0.43%	0.00%	TA: 0.22%
Indica III	913	98.60%	0.80%	0.00%	0.00%	TAA: 0.66%
Indica Intermediate	786	95.20%	3.10%	0.76%	0.00%	TAA: 0.89%; TA: 0.13%
Temperate Japonica	767	3.30%	89.20%	7.56%	0.00%	NA
Tropical Japonica	504	47.40%	51.60%	0.99%	0.00%	NA
Japonica Intermediate	241	15.40%	81.70%	2.07%	0.00%	TA: 0.41%; TAAA: 0.41%
VI/Aromatic	96	77.10%	14.60%	3.12%	0.00%	TAAA: 5.21%
Intermediate	90	55.60%	41.10%	1.11%	0.00%	TTAA: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0919233052	T -> TAA	LOC_Os09g32220.1	upstream_gene_variant ; 2140.0bp to feature; MODIFIER	silent_mutation	Average:85.953; most accessible tissue: Callus, score: 97.731	N	N	N	N
vg0919233052	T -> TAA	LOC_Os09g32210-LOC_Os09g32220	intergenic_region ; MODIFIER	silent_mutation	Average:85.953; most accessible tissue: Callus, score: 97.731	N	N	N	N
vg0919233052	T -> TTAA	LOC_Os09g32220.1	upstream_gene_variant ; 2140.0bp to feature; MODIFIER	silent_mutation	Average:85.953; most accessible tissue: Callus, score: 97.731	N	N	N	N
vg0919233052	T -> TTAA	LOC_Os09g32210-LOC_Os09g32220	intergenic_region ; MODIFIER	silent_mutation	Average:85.953; most accessible tissue: Callus, score: 97.731	N	N	N	N
vg0919233052	T -> A	LOC_Os09g32220.1	upstream_gene_variant ; 2141.0bp to feature; MODIFIER	silent_mutation	Average:85.953; most accessible tissue: Callus, score: 97.731	N	N	N	N
vg0919233052	T -> A	LOC_Os09g32210-LOC_Os09g32220	intergenic_region ; MODIFIER	silent_mutation	Average:85.953; most accessible tissue: Callus, score: 97.731	N	N	N	N
vg0919233052	T -> TAAA	LOC_Os09g32220.1	upstream_gene_variant ; 2140.0bp to feature; MODIFIER	silent_mutation	Average:85.953; most accessible tissue: Callus, score: 97.731	N	N	N	N
vg0919233052	T -> TAAA	LOC_Os09g32210-LOC_Os09g32220	intergenic_region ; MODIFIER	silent_mutation	Average:85.953; most accessible tissue: Callus, score: 97.731	N	N	N	N
vg0919233052	T -> TA	LOC_Os09g32220.1	upstream_gene_variant ; 2140.0bp to feature; MODIFIER	silent_mutation	Average:85.953; most accessible tissue: Callus, score: 97.731	N	N	N	N
vg0919233052	T -> TA	LOC_Os09g32210-LOC_Os09g32220	intergenic_region ; MODIFIER	silent_mutation	Average:85.953; most accessible tissue: Callus, score: 97.731	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0919233052	T	A	0.03	0.02	0.03	0.0	0.02	0.02
vg0919233052	T	TA	0.04	-0.05	-0.07	-0.05	-0.07	-0.09
vg0919233052	T	TAA	0.04	-0.05	-0.06	-0.01	-0.01	0.02
vg0919233052	T	TAAA	0.06	-0.04	-0.04	-0.03	0.0	0.03
vg0919233052	T	TTAA	0.03	-0.06	-0.05	-0.04	-0.01	0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0919233052	NA	6.61E-07	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919233052	2.70E-06	4.40E-11	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919233052	NA	1.71E-09	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919233052	NA	3.67E-06	mr1944	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919233052	NA	9.76E-11	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919233052	2.62E-06	NA	mr1598_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919233052	1.77E-07	2.17E-14	mr1598_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251