\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919233052:

Variant ID: vg0919233052 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 19233052
Reference Allele: TAlternative Allele: A,TAAA,TA,TAA,TTAA
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, A: 0.30, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TCAAAATCCTGTAAATTTCACTTTCTGTGTCATTGTAACTGAAGTCCTAGACAGCAACGGGTTGTTTGAATATCTGGTTTGACCAAAGCTCATTTTTTTT[T/A,TAAA,TA,TAA,TTAA]
AAAAAAAACAGATAGAAGTCTACCAACCTAGAATTTGTTTTGTTTGTTAGGATCTCGTGACCTAAGAAAGTGGGGATAATCTGGTGAAGAAAAAAAAACT

Reverse complement sequence

AGTTTTTTTTTCTTCACCAGATTATCCCCACTTTCTTAGGTCACGAGATCCTAACAAACAAAACAAATTCTAGGTTGGTAGACTTCTATCTGTTTTTTTT[A/T,TTTA,TA,TTA,TTAA]
AAAAAAAATGAGCTTTGGTCAAACCAGATATTCAAACAACCCGTTGCTGTCTAGGACTTCAGTTACAATGACACAGAAAGTGAAATTTACAGGATTTTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.80% 26.80% 1.71% 0.00% TAA: 0.30%; TA: 0.15%; TAAA: 0.15%; TTAA: 0.04%
All Indica  2759 96.70% 2.40% 0.33% 0.00% TAA: 0.51%; TA: 0.07%; TAAA: 0.04%
All Japonica  1512 19.90% 75.50% 4.50% 0.00% TA: 0.07%; TAAA: 0.07%
Aus  269 94.80% 3.70% 0.00% 0.00% TA: 1.49%
Indica I  595 97.10% 2.40% 0.17% 0.00% TAAA: 0.17%; TAA: 0.17%
Indica II  465 94.80% 4.50% 0.43% 0.00% TA: 0.22%
Indica III  913 98.60% 0.80% 0.00% 0.00% TAA: 0.66%
Indica Intermediate  786 95.20% 3.10% 0.76% 0.00% TAA: 0.89%; TA: 0.13%
Temperate Japonica  767 3.30% 89.20% 7.56% 0.00% NA
Tropical Japonica  504 47.40% 51.60% 0.99% 0.00% NA
Japonica Intermediate  241 15.40% 81.70% 2.07% 0.00% TA: 0.41%; TAAA: 0.41%
VI/Aromatic  96 77.10% 14.60% 3.12% 0.00% TAAA: 5.21%
Intermediate  90 55.60% 41.10% 1.11% 0.00% TTAA: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919233052 T -> TAA LOC_Os09g32220.1 upstream_gene_variant ; 2140.0bp to feature; MODIFIER silent_mutation Average:85.953; most accessible tissue: Callus, score: 97.731 N N N N
vg0919233052 T -> TAA LOC_Os09g32210-LOC_Os09g32220 intergenic_region ; MODIFIER silent_mutation Average:85.953; most accessible tissue: Callus, score: 97.731 N N N N
vg0919233052 T -> TTAA LOC_Os09g32220.1 upstream_gene_variant ; 2140.0bp to feature; MODIFIER silent_mutation Average:85.953; most accessible tissue: Callus, score: 97.731 N N N N
vg0919233052 T -> TTAA LOC_Os09g32210-LOC_Os09g32220 intergenic_region ; MODIFIER silent_mutation Average:85.953; most accessible tissue: Callus, score: 97.731 N N N N
vg0919233052 T -> A LOC_Os09g32220.1 upstream_gene_variant ; 2141.0bp to feature; MODIFIER silent_mutation Average:85.953; most accessible tissue: Callus, score: 97.731 N N N N
vg0919233052 T -> A LOC_Os09g32210-LOC_Os09g32220 intergenic_region ; MODIFIER silent_mutation Average:85.953; most accessible tissue: Callus, score: 97.731 N N N N
vg0919233052 T -> TAAA LOC_Os09g32220.1 upstream_gene_variant ; 2140.0bp to feature; MODIFIER silent_mutation Average:85.953; most accessible tissue: Callus, score: 97.731 N N N N
vg0919233052 T -> TAAA LOC_Os09g32210-LOC_Os09g32220 intergenic_region ; MODIFIER silent_mutation Average:85.953; most accessible tissue: Callus, score: 97.731 N N N N
vg0919233052 T -> TA LOC_Os09g32220.1 upstream_gene_variant ; 2140.0bp to feature; MODIFIER silent_mutation Average:85.953; most accessible tissue: Callus, score: 97.731 N N N N
vg0919233052 T -> TA LOC_Os09g32210-LOC_Os09g32220 intergenic_region ; MODIFIER silent_mutation Average:85.953; most accessible tissue: Callus, score: 97.731 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0919233052 T A 0.03 0.02 0.03 0.0 0.02 0.02
vg0919233052 T TA 0.04 -0.05 -0.07 -0.05 -0.07 -0.09
vg0919233052 T TAA 0.04 -0.05 -0.06 -0.01 -0.01 0.02
vg0919233052 T TAAA 0.06 -0.04 -0.04 -0.03 0.0 0.03
vg0919233052 T TTAA 0.03 -0.06 -0.05 -0.04 -0.01 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919233052 NA 6.61E-07 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919233052 2.70E-06 4.40E-11 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919233052 NA 1.71E-09 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919233052 NA 3.67E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919233052 NA 9.76E-11 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919233052 2.62E-06 NA mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919233052 1.77E-07 2.17E-14 mr1598_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251